Objectives: To evaluate the hypothalamic-pituitary-adrenal (HPA) axis sensitivity to dexamethasone (DEX), NR3C1 polymorphisms (SNPs), gene expression of GRα and GRβ isoforms, and a panel of cytokines (IL1B, IL2, IL4, IL6, IL8, IL10, TNF and IFNG) in peripheral immune cells of MetS patients and controls.

Materials and Methods: Prospective study with 40 MetS patients and 40 controls was conducted at the School of Medicine of Ribeirao Preto University Hospital. Plasma (PF) and salivary (SF) cortisol were measured by RIA in basal conditions and after 0.25, 0.5 and 1mg of DEX given at 2300h. In addition, p.N363S (rs6195), p.ER22/23EK (rs6189-6190), and BclI (rs41423247) SNPs were evaluated by qPCR allelic discrimination. Exons 3 to 9 and exon/intron boundaries of NR3C1 were sequenced. GR isoforms and cytokines expression were assessed by qPCR.

Results: PF (nmol/l) and SF (nmol/l) after 0,5mg DEX were higher in MetS patients compared to controls (PF: 119.0±24 vs. 57.5±2.9; p=0.07 and SF: 7.6±2.0 vs. 4.5±1.3; p=0.05) and also after 1mg DEX (PF: 70.2±17.3 vs. 37.9±2.6; p=0.02 and SF: 4.9±1.7 vs. 2.2±0.3; p<0.0001). After all DEX doses, a lower number of MetS patients suppressed PF and SF compared to controls. The BclI genotypic frequencies (%) differed between patients and controls (CC:56/CG:44 and CC:50/CG:32.5/GG:17.5; respectively, p=0.03). TheGRβ was overexpressed (fold=100.0; p=0.002) and IL4 (fold=-265.0; p<0.0001) was underexpressed in MetS patients.

Conclusions: MetS patients exhibited decreased hypothalamus-pituitary sensitivity to GC feedback, confirming the HPA axis activation in this condition. The lower frequency of the BclI polymorphism may contribute to this HPA axis dysregulation. Moreover, the MetS low grade chronic inflammation appears to promote GRβ overexpression, resulting in tissue-specific GC resistance, one of the mechanisms through which GCs may consume peripheral subcutaneous adipose tissue and promote the preferential expansion of visceral adipose tissue. Our data support the emerging concept that HPA axis disruption might be involved in the incompletely understood pathogenesis of MetS.

In the present study, we studied a novel topoisomerase I inhibitor, LMP-400, as a potential treatment for this disease. First, we evaluated presence of topoisomerase I in human metastatic tumors. We found a significantly higher expression of topoisomerase I in these tumors compared to normal adrenal medulla and primary tumors, which provided us with a basis for further studies. LMP-400 inhibited cell growth of established mouse and rat PHEO cell lines and also of human primary tumor tissue cells in vitro. In a study performed in athymic female mice, LMP-400 showed a significant inhibitory effect on tumor growth and metastases formation in two evaluated drug administration regimens. Furthermore, we studied effects of the compound on hypoxia pathway and we found that low doses of LMP-400 decreased protein levels of hypoxia-inducible factor 1 alpha (HIF-1α), one of the transcription factors studied as potential metastatic drivers in these tumors. HIF-1α decrease resulted in changes in the mRNA levels of HIF-1α transcriptional targets. In addition, we performed in vitro cell growth inhibition studies combining LMP-400 with other chemotherapeutic drugs currently used in clinics and it showed an increased growth inhibitory effect in the combination than when treated individually.

In conclusion, we believe that based on our results showing the inhibitory effect of LMP-400 on tumor growth in vitro and in vivo and affecting hypoxia pathway, which plays a major role in these tumors, the compound is a promising treatment option for patients with metastatic PHEO/PGL. In addition, its effect at low concentrations in combination with other drugs makes it a very potential candidate for its use in future clinical trials.

Methods: Following ethical approval, we carried out a single-blinded placebo-controlled study. A group of older men (mean age 61.0yrs) and a control group of younger men (mean age 28.9yrs) each underwent 3 study visits at least 1 week apart, during which they received vehicle, kisspeptin or GnRH (n=5 per group). Ten minutely blood sampling for luteinizing hormone (LH), follicle stimulating hormone (FSH) and testosterone was performed throughout each 4h study visit. After 1h of baseline blood sampling, a 3h intravenous infusion of vehicle, 0.1 nmol/kg/h of KP54 or GnRH, was commenced and reproductive hormonal response assessed. Mean AUC of change in each reproductive hormone from baseline was compared by unpaired t test with P<0.05 regarded as significant.

Results: Mean BMI and baseline testosterone were 23.6 kg/m², 20.6 nmol/l in the young men (YM) and 25.4 kg/m², 16.9 nmol/l in the older male (OM) groups, respectively. No significant differences were observed in the LH responses between young and older men following either KP54 or GnRH infusion (mean±SEM AUC LH change in iU.h/L: KP54 YM 12.1±1.6, KP54 OM 12.1±2.0, P=ns vs. KP54 YM; GnRH YM 19.6±3.2, GnRH OM 18.6±3.4, P=ns vs. GnRH YM). FSH response was not significantly different in the older age group to both KP54 and GnRH (mean±SEM AUC change in FSH in iU.h/L: KP54 YM 1.6±0.3, OM 2.5±0.8, P=ns vs. KP54 YM; GnRH YM 2.3±0.4, OM 4.1±1.8; P=ns vs GnRH YM).

Conclusion: This pilot study suggests that older men without known LOH have similar reproductive hormonal response to KP54 when compared with younger men. Thus KP54 offers a potential novel tool for examining hypothalamic function in older men.

Objective: We hypothesized that exogenous GH modulates hypoxia-induced disturbances of the GH/IGF-1 axis mediating protective effects under global hypoxia during early development.

Methods: A total of 179 mice were randomized at postnatal day 7 (P7) according the complete block design into treatment groups of at least 8 animals and exposed either to normoxia or hypoxia (8% O₂) for 6h using an INVIVO₄₀₀ hypoxia workstation (Baker Ruskinn). Within 30 min after reoxygenation and once daily for three consecutive days, recombinant hGH (Genotropin^®, Pfizer) at doses of 0, 10, 50, 250, 1000, and 4000 µg/kg was injected intraperitoneal (i. p.) in the pups. Body weight and length (nose-to-tail length) were monitored and mGH and IGF-1 plasma protein concentrations were quantified at P14 and P21.

Results: Whereas no physiological differences between the treatment groups were observed at P7, treatment with low hGH doses adversely affected perinatal growth and weight gain under normoxia. Mice dosed with 10–250 µg/kg hGH gained 72% less weight (P<0.0001) until P10 and were significantly shorter than non- or sham-treated mice. Thereby, growth retardation persisted until P21 in mice treated with 10 and 50 µg/kg hGH and were correlated to significantly decreased plasma concentration of mGH and IGF-1. Hypoxia-exposed non- and sham-treated animals revealed significantly lower weight gain (P<0.0001) between P7 and P10 than normoxic animals. Simultaneously, exposure to hypoxia significantly decreased plasma mGH (P<0.05) and IGF-1 levels (P<0.05) for at least one week. Notably, treatment with 1000 and 4000 µg/kg hGH restored hypoxia-induced disturbances of the GH/IGF-1 axis compensating growth deficiency in neonatal mice.

Conclusion: Our data indicate that i) perinatal, hypoxia-induced disturbances of the GH-/IGF-1 axis are transient and that ii) hGH treatment stabilizes the somatotropic axis after perinatal hypoxia. Further studies are focused on modification of cerebral neurotropic factors by stabilization of the GH/IGF-1 axis and thus preventing neuronal loss in the developing hypoxic rodent brain.

Aim: To test if GHR gene polymorphisms are associated to height and components of the GH/IGF-I/IGFBPs system in ISS children.

Methods: GHR gene (Ex/In flanking regions) was PCR-amplified and sequenced in 75 unrelated ISS children. The GHR pseudoexon (6Psi) mutation was investigated by RFLP. GHR gene variants were classified as rare (minor allele frequency (MAF) ≤ 1%), less frequent (1-10%) and common (≥ 10%). To test the genotype influence of SNPs with MAF > 10% (HapMap-Project) on height and GH/IGF-I/IGFBPs system, ISS children were grouped as homozygous for the major allele and carriers of one or two copies of the minor allele. The proportion of variants (less than 3 versus 4 or more) was evaluated according to the median value of: height (-2.86 SDS), GHBP (-0.9 SDS; in house functional assay), maximal stimulated-GH (14.9 ng/L), IGF-I (-1.4 SDS), IGFBP-3 (-1.0 SDS, ICMA) and ALS (-1.3 SDS; RIA). Hardy-Weinberg equilibrium, Fisher´s exact test and Mann-Whitney analysis were used.

Results: Six common and 5 less frequent variants were identified: Ex3 deletion (MAF: 26%), rs6179 (Ex6, 23%), rs6180 (Ex10, 42%), rs12521020 (In1, 32%), rs10941579 (In2, 32%), rs33972388 (In7, 37%), rs34223737 (In7, 1%), rs6880730 (In8, 5%), rs6182, rs6184 and rs115376349 (Ex10, 2%). In ISS, MAF distribution was not different from 41 control children or the HapMap database. We identified 4 heterozygous rare variants in 4/75 children (5.3%): p.R229H (Ex7) and p.R386C (Ex10) with normal IGF-I, IGFBP-3 and ALS levels, 1 of them with low GHBP (<-1.9 SDS); rs143475648 (In3) with low GH-dependent biomarkers and c.618+700_705dupCAGCCA (In6) with low IGF-I levels. These variants were not found in control children. Neither individual GHR gene genotypes, nor the sum of GHR polymorphic variants were associated to height, GHBP, IGF-I, IGFBP-3 or ALS (p>0.06).

Conclusions: The sum of polymorphic variants has no effect on GH sensitivity, measured by levels of serum GHBP, IGF-I, IGFBP-3 and ALS. While p.R229H variant may result in a slight reduction in GHR expression as reflected by low GHBP levels, p.R386C, rs143475648 and c.618+700_705dupCAGCCA variants remain to be characterized by in vitro functional studies.

The rate of normal growth tends to increase in mid-spring/summer and is greater in children living at higher latitudes(1). This study examined i) the impact of living at different latitudes on height velocity (HV) and ii) the interactions between environmental [latitude, summer daylight exposure (SDE)] and genomic factors [single nucleotide polymorphisms (SNPs), gene expression (GE) profiles] that effect HV in response to treatment with recombinant-human growth hormone (r-hGH) in children with growth hormone deficiency (GHD).

Methods

Pre-pubertal naïve GHD patients (n=118) from the PREDICT prospective long-term follow-up study (NCT00699855) were analyzed. The effect of treatment over one year with r-hGH was measured by HV (cm/yr) and assessed in relation to SDE, carriage of seven SNPs previously associated with high growth response(2) and basal GE determined prior to treatment. Data were submitted from 28 centers in 14 countries SDE and HV were correlated with basal GE using rank regression and network models were constructed from the GE overlap to investigate causal interactions.

Results

GHD patients from latitudes with higher SDE had a better HV in response to r-hGH compared to those with intermediate and lower SDE [median (Q1, Q3): 9.8 (8.5, 11.4) vs 8.1 (7.0, 9.8) and 8.2 (7.0, 10.3) cm/yr, respectively; p=0.019], with HV over all groups correlating with SDE (r=0.256, p=0.006). For SNPs within GRB10, IGFBP3, TGF-α, CYP19A1 and TP53 genes, there was a significant interaction between the SNP and SDE (p<0.05) in relation to growth response. The effect of carriage of SNPs in IGFBP3, TGF-α and TP53 on HV was greater in patients from locations with higher SDE; while the converse was found for GRB10 and CYP19A1 Network models derived from SDE and HV associated basal GE identified i) the developmental transcription factor NANOG as a key regulator, and ii) up-regulation of growth-related and “circadian clock” pathways (p=3.0x10^-3).

Conclusion

This study showed complex gene-environment interactions between genes modulating growth and SDE in response to r-hGH, with the biological regulation of the circadian clock as a possible linking mechanism. The transcriptional regulator NANOG was found to be a master regulator of these interactions implicated in the development of circadian oscillator action and bone growth.

The study was a 24-week, open-label, parallel-arm trial in 325 patients taking 201 to 600 units/day U-100 insulin therapy with or without oral antihyperglycemic agents. Patient demographics (means ± SD) included age, 55.4 ± 9.8 years; duration of diabetes, 15.2 ± 7.4 years; BMI, 41.9 ± 7.5 kg/m²; HbA_1c, 8.7 ± 1.0%; U-100 insulin dose, 287.5 ± 80.5 units administered in 5 injections/day (median; range, 2 to 10). Patients were randomized to either thrice-daily (TID, n = 162) or twice-daily (BID, n = 163) U-500R after a 4-week lead-in period. The transition formula from U-100 insulins (predominantly basal–bolus analogue therapy) to U-500R reduced the total daily dose (TDD) by 20% for those with baseline HbA_1c ≤8.0% or mean self-monitored plasma glucose (SMPG) <183 mg/dL. Otherwise, a 1:1 transition was used. Initial U-500R dosing proportions were 40:30:30 (breakfast:lunch:dinner) for TID and 60:40 (breakfast:dinner) for BID. Both algorithms adjusted TDD at each visit up to +30% (‑20% for hypoglycemia) to achieve pre-meal SMPG 71 to 130 mg/dL.

After 24 weeks, both treatments demonstrated significant and comparable reductions in HbA_1c from baseline (TID, ‑1.12% [endpoint HbA_1c, 7.53% ± 1.1%]; BID, ‑1.22% [endpoint HbA_1c, 7.41% ± 1.0%]; P < 0.001 for both) and clinical equivalence (difference [BID vs. TID], ‑0.10% [P = 0.37]; 95% CI, ‑0.33% to 0.12%) at the non-inferiority margin 0.4%. Proportions of patients reaching HbA_1c target values were similar between the 2 regimens (<8.0%: TID 70%, BID 69%; <7.5%: TID 55%, BID 47%; and <7.0%: TID 29%, BID 31%). Comparable increases in U-500R TDD (TID, 242.7 to 343.1 units; BID, 249.0 to 335.0 units) were observed. Severe hypoglycemia was uncommon and occurred with similar incidence (TID: 3 patients [1.9%]; BID: 6 patients [3.7%]). Incidence and rate of documented symptomatic hypoglycemia (≤70 mg/dL) were lower for TID compared with BID (P = 0.003 and P = 0.02, respectively). Weight gain was similar between regimens (TID, 5.4 ± 0.4 kg; BID, 4.9 ± 0.4 kg).

In summary, initiation and titration of U-500R using either algorithm (TID or BID) improves glycemic control effectively and safely with fewer injections in patients with T2D on high-dose/high-volume U-100 insulin. These results provide clinicians with a practical framework for using U-500R in severely insulin-resistant patients with suboptimally controlled T2D.

Objective:  To determine the impact of U500 insulin on outcomes in MIRD.

Methods:  Retrospective chart reviews of 324 patients on TDD ≥200 units, identified from pharmacy records, who were either transitioned to U500 insulin therapy (U500 cohort, n=180) or maintained on U100 insulin therapy (U100 cohort, n=144) by patient/provider choice.

Outcome Measures: Mortality, microvascular and macrovascular complications between MIRD onset (verified from prescription signatures/progress notes) and date of last contact/death.

Results:  The number of patients with MIRD rose 10-fold between 2001 and 2013, while U500 insulin use rose 25-fold.  MIRD was associated with a high prevalence of diabetes-related vascular complications at onset, both macrovascular (259/324 [80%], principally CAD: 167/324 [51.5%]) and microvascular (199/324 [61.4%], principally nephropathy: 156/324 [48.2%]).  Patients transitioned to U500 insulin had a significantly lower mortality compared to those who remained on U100 insulin (27/180[15%] vs 39/144[27.1%], p=0.011), reflecting a 41% survival benefit on KM analysis (Hazard Ratio=0.59, p=0.0336) over similar follow-up duration (U500:1431±61days [Mean±SE], U100:1501±84), despite virtually identical clinical characteristics at MIRD onset.  Microvascular  complications were significantly reduced in the U500 cohort (105/180[58.3%] vs U100: 107/144[74.3%], p=0.003), specifically diabetic nephropathy (U500: 53/180[29.4%) vs U100: 79/144[54.9%], p<0.0001), both new onset (U500: 25/100[25%] vs U100: 33/68[48.5%], p=0.0016) and progressive (U500: 28/80[30%] vs U100: 33/68[48.5%], p=0.0014).  Macrovascular disease was impacted only marginally (U500: 53/180[29.4%] vs U100: 57/144[39.6%], p=0.056), principally from preventing peripheral arterial disease (PAD; U500:4/180[2.2%] vs U100:16/144[11.1%], p=0. 005), but not CAD (U500: 46/180[25.6%] vs U100: 41/144[28.5%],p=NS) or CVA (U500:6/180[3.3%] vs U100: 8/144[5.6%], p=NS).

Hemoglobin A1c in the U500 cohort decreased 0.91±0.1% (p<0.01), associated with an increase in TDD of 108±10units (p<0.01) and weight gain of 6.9±0.9kg (p<0.01), but A1c, weight and TDD did not change significantly in the U100 group. 

Conclusions:  MIRD is associated with high morality and frequent vascular complications, but substantial reductions in mortality and onset/progression of nephropathy and PAD can result from higher TDD and lower A1c associated with U500 therapy.  By contrast, worse outcomes may be attributable to “dose inertia” associated with U100 therapy in MIRD.

Patients with a pNET were selected from the MEN1 database of the DMSG including >90% of the Dutch MEN1 population >16 years with an average of 21 years of follow-up (n=323) (3). Patients were considered to have a pNET if found at pathology and/or diagnosed on the base of CT,MRI or EUS and confirmed at least once on subsequent imaging. For growth analysis CT/MRI was used and the size (mm) of the largest tumor in the pancreatic head and/or body-tail was followed over time. Size was analyzed from the first moment a tumor was identified until the end of follow-up, surgical removal or start of systemic anti-tumor therapy. Growth analysis was performed using Linear Mixed Models analysis to account for clustering of observations within patients. Gender, age, genotype, use of somatostatin analogues (SSA) and serum calcium were investigated as possible effect modifiers. To correlate tumor growth with disease related outcome, adverse outcome (pNET-related liver metastases or death) was analyzed for possible effect modification.

PNET was present in 159 (49%) patients. Ninety-two tumors from 82 patients were available for growth analysis. Thirthy-six patients (44%) were male. Median age at diagnosis of the tumor was 40 years. Baseline tumor size was 12 mm (range 3-82 mm). Twenty (22%) tumors were eventually surgically removed, baseline tumor size for these tumors was 17 mm (range 5-82). No clinically relevant growth was observed during a median follow-up of 4 (range 0.5-16.5) years:  the average growth rate of pNETs was <1 mm/year. Tumors that were surgically removed had a statistically significant higher growth rate, however this was still <1 mm/year. Growth rate did not differ by gender, age, genotype, use of SSA or serum calcium. Tumors from patients in whom during follow-up an adverse outcome was documented had a statistically significant somewhat higher growth rate, but still <1 mm/year.

In this large patient group during long term follow-up, the growth rate of pNETs in MEN1 appears to be slower than previously thought and was not influenced by gender, age, genotype, use of SSA and serum calcium. Present results do not support a clinically relevant relation between growth rate and adverse outcome indicating that tumor growth rate cannot be used as indicator for surgery.

Patients We screened macro TSH in 1083 patients with subclinical hypothyroidism (634 women and 449 men, aged 64.6 ± 17.7 years) followed at our hospital, and in 54 serum samples that were sent to our laboratory from doctors in other hospitals, suspecting the presence of macro TSH.

Measurements Macro TSH was screened by polyethylene glycol (PEG) method, in which macro TSH was precipitated with 12.5% PEG. The PEG-precipitable TSH (%), which may represent the amount of macro TSH, was calculated as (total TSH - free TSH) / total TSH × 100. Serum samples that exhibited PEG-precipitable TSH ratios greater than 75% (mean + 1.5 SD in controls) were subjected to gel filtration chromatography to confirm macro TSH. The biological activity of macro TSH was examined in the FRTL-5 rat thyroid cell line. Protein G column and HAMA (human anti-mouse antibodies) blockers were used to characterize macro TSH. Macro PRL was examined in patients with macro TSH using the same method as macro TSH.

Results Among 1083 patients with subclinical hypothyroidism, 14 patients had macro TSH (1.3%). Among 54 serum samples that were requested to examine the presence of macro TSH, 5 serum samples were found to containe macro TSH. The nature of macro TSH in these 19 serum samples included 14 anti-TSH autoantibodies of IgG class, 2 non-IgG-associated, and 3 HAMA. Macro TSH showed low bioactivity compared to the immunoreactivity. Three patients with macro TSH also had macro PRL.

Conclusions Macro TSH was heterogeneous, but it is mostly comprised of TSH and anti-TSH autoantibodies. Because 3 of 19 patients with macro TSH also had macro PRL, common mechanisms may be involved in the generation of macro TSH and macro PRL in some patients. When PEG-precipitable TSH exceeds 90% in serum samples with TSH above 10 mU/l, clinicians should strongly suspect the presence of macro TSH and confirm it by gel chromatography. Because macro TSH exhibited low bioactivity, thyroid hormone replacement therapy may not be required in patients with subclinical hypothyroidism due to macro TSH except for those with high serum free TSH levels.

Methodology: The introduction of a higher radioiodine dose into the Royal Surrey County Hospital in 2008 generated two treatment cohorts for hyperthyroid patients: a low dose cohort (n=62) receiving 350MBq, and a high dose cohort (n=102) where Grave’s disease patients received 415MBq and MNG or STN patients received 475MBq. A retrospective cohort study was conducted analysing the effect of this dose increase, as well as various other factors, on proportion hyperthyroid and proportion hypothyroid at one year, and time to absence of hyperthyroidism.

Results: At one year post-radioiodine, 32 (19.5%) patients were hyperthyroid, 37 (22.6%) patients were euthyroid, and 95 (57.9%) were hypothyroid. The higher radioiodine dose had no impact on all treatment outcomes. The use of ATDs post-radioiodine (OR=2.346; 95%CI=1.071-5.138; p=0.033), and a high free thyroxine (fT4) in the year prior to treatment (OR=8.499; 95%CI=1.231-58.707; p=0.03) were associated with increased risk of hyperthyroidism at one year. ATDs post-radioiodine (adj. HR=0.445; 95%CI=0.308-0.643; p<0.0005) and high fT4 (HR=0.627; 95%CI=0.420-0.935; p=0.022) also significantly prolonging time to absence of hyperthyroidism, with the effect of ATDs being maintained on multivariate analysis.

Conclusions: As higher dose radioiodine therapy did not alter treatment outcomes, contrary to current guidelines, the use of lower dose (350MBq) therapy in hyperthyroidism would be most appropriate, to mitigate any risks of long-term complications. In addition, provided a patient’s clinical status permits, the use of carbimazole or PTU post-radioiodine should be avoided due to their effects on radioiodine uptake.

4300 women were recruited from obstetric clinics in Glasgow, UK between 2007-2010 as part of the “Proteomics in Pre-eclampsia” study. Plasma samples and clinical data were obtained at the initial antenatal hospital visit at gestational week 12-14. Data on pregnancy outcomes was obtained from hospital databases. Birthweight centiles, corrected for maternal age, ethnicity, baby sex and gestational age were used. Thyroid stimulating hormone (TSH) and free thyroxine (fT4) levels were analysed in 2014 using clinically validated platforms (Roche, UK). In women with abnormal thyroid tests in pregnancy, hospital databases were used to identify more recent thyroid problems.

Delivery information was available on 4179 (97.2%) women: 3889 (90.4%) were Caucasian, 36 miscarried, and 87 (2%) developed pre-eclampsia. 73 women were known to have pre-existing thyroid disease and were not included in the analysis; of them 28 (38%) had a TSH above 2.5mU/L.

58 women were identified as having OH (TSH>5 mU/l), of whom 2 were later diagnosed during pregnancy and 7 have been diagnosed since pregnancy. 8 women were found to have isolated hypothyroxinaemia (fT4 <9 pmol/l) . 406 women (10.6%) were identified as having SCH (TSH >2.5 mU/L but <5mU/L, and fT4 within the non-pregnant reference range). Women with OH delivered babies of lower birthweight than those with normal thyroid function (3196g ± 805 vs 3403g ± 402, p=0.02, corrected centile 37±12 vs 44±14, p=0.05), there was no difference in birthweight between women with SCH and those with normal thyroid function. There was no relationship between early pregnancy thyroid tests and rates of pre-eclampsia, gestational diabetes, miscarriage, preterm delivery or Caesarean section.

Retrospective screening of thyroid function in this unselected obstetric cohort identified 1.4% of women having OH, and these women delivered infants of lower birthweight. In women known to have thyroid disease, more than a third had a TSH above the pregnancy reference range. 10% were identified as having SCH, which did not impact upon obstetric outcomes. Recent guidelines suggest that if identified, women with SCH should be treated with thyroxine. This treatment, and the subsequent monitoring required would have major implications for design and costing of obstetric services.

There have been advances in our understanding of Graves’ disease over the last two decades, particularly with regard to the risks of anti-thyroid drugs and increased concern over the long term effects of radiation exposure, as well as advances in surgical techniques. Research into the effects of the disease and it’s treatments during pregnancy have also led to shifts in practice over this time. Multiple surveys were undertaken in the late 1980’s and early 1990’s looking at clinical practice patterns amongst physicians in the US, Europe and Australasia and recently several of these surveys have been repeated to assess the shifts in practice over time.

Objective

The aim of this study was to assess the current management of Graves’ disease by New Zealand (NZ) endocrinology/internal medicine specialists and to compare findings with those of contemporary international studies and a previous 1991 New Zealand survey¹.

Methods

We conducted an online case-based survey of all NZ physicians practising in the area of internal medicine, diabetes and/or endocrinology. Physicians were identified from the NZ Medical Council register. The case studies and questions from the previous 1991 NZ study were reformatted into an online survey and the link was emailed to the list of physicians.  A total of 117 physicians were invited to participate. Of these six were unable to be located, two had retired, two were on extended leave throughout the survey time period and one had permanently left NZ. Respondents who treated <2 patients/year with Graves’ disease were asked only to complete the sections on demographics and access to services. 

Results

In comparison to the 1991 NZ survey¹ the first-line use of Radioiodine was less, at only 3%, compared with 41%, using the same clinical scenario. This corresponded with an increase in the use of antithyroid drugs, while the rates of surgery as a first line treatment remained fairly static over time. This is more in line with the current practice of our European colleagues than with Endocrinologists in North America who continue to report higher rates of RAI use². In the index case, all respondents opted for carbimazole as their drug of choice (methimazole is not available in NZ). When the case was altered to a woman desiring pregnancy 28% would instead use PTU pre-pregnancy, while 56% would switch to PTU once the patient became pregnant. Both of these figures suggest NZ physicians use PTU less in pregnancy compared with international practice. Access to services, particularly nuclear medicine imaging, was an issue for 23% of respondents.

Conclusions

Practice in NZ has changed over the last twenty years, with a move away from radioactive iodine treatment. This parallels changes in practice in Europe and to a lesser extent America. NZ physicians appear to use PTU less commonly pre-pregnancy, although the majority would switch to PTU in early pregnancy.

Gut microbes have been shown to play significant roles in metabolic dysfunction and the development of obesity. Of these, the methanogenic archaea have been specifically linked to altered metabolism and weight gain. We have previously shown that the presence of both methane and hydrogen on breath test (a surrogate for gastrointestinal colonization with methanogens) is associated with greater body mass index (BMI), percent body fat, as well as glucose intolerance. Since alterations in gut microbial populations are also associated with weight loss following gastric bypass surgery, we investigated whether methane and hydrogen on breath test was associated with differential weight loss after Roux- en-Y gastric bypass.

Methods

Obese subjects aged 18 to 70 years with a pre-surgery BMI ≥ 35 were recruited at ≥ 4 months after bariatric surgery (Roux-en-Y or gastric sleeve). Pre- and post-surgery weights and BMIs were recorded, and single sample breath tests were performed to determine post-surgery methane and hydrogen levels. BMI and body weight changes were normalized to 6 months post surgery.

Results

A total of 156 subjects were recruited (112 females, 44 males). The average age was 47.9 ± 0.9 years and the average pre-surgery BMI was 42.6 ± 0.3. For all subjects, % change in weight and % change in BMI were normalized for pre-surgery BMI. Using cutoffs of methane ≥3 ppm and hydrogen ≥20 ppm to define methane and hydrogen positivity (M+/H+), M+/H+ subjects (n=13) had a lower % change in BMI than all other subjects (n=144) following surgery (20.6±1.9 vs. 23.5±0.6 respectively, p=0.13), and also had a significantly lower % change in weight (20.05±1.8 vs. 23.9±0.5 respectively, p=0.036). When cutoffs of methane ≥3 ppm and hydrogen ≥10 ppm were used to define methane and hydrogen positivity, M+/H+ subjects (n=18) still exhibited a lower prorated % change in BMI following surgery than all other subjects (n=139) (20.4±1.6 vs. 23.6±0.6 respectively, p=0.057), as well as a significantly lower prorated % change in weight than (20.1±1.5 vs. 24.0±0.5 respectively, p=0.014).

Conclusions

Subjects with gastrointestinal methanogen colonization (as determined by methane and hydrogen levels on breath test) exhibited less % weight loss and % BMI reduction than subjects without detectable methanogen colonization following Roux-en-Y gastric bypass surgery. This was shown regardless of whether a breath hydrogen level of ≥20 ppm or the more stringent level of ≥10 ppm was used to define hydrogen positivity.  Altering methanogenic colonization via pharmacotherapy and/or dietary interventions may provide additional benefit in those achieving less than optimal weight loss post gastric bypass surgery.

Objective: To determine the effect of 10 days of a fructose- but not calorie- restricted diet on DNL in obese Latino and African American children with high habitual dietary sugar intake.

Design/Methods: Latino (8F, 9M) and African American (4F, 1M) children (ages 9-18; BMI z-score 2.4 ± 0.1), who were high dietary sugar consumers at baseline (average fructose intake >50 g/day), had all meals provided for 10 days with the same caloric and macronutrient composition as their standard diet, but with other carbohydrate substituted for sugar. Subjects were weighed daily and diets adjusted to maintain baseline weight. Fractional DNL and DNL area under the curve (DNL-AUC) were measured over 8 hours of test meal feeding on Day 0 (high fructose) and Day 10 (low fructose). Test meals contained 1-¹³C sodium acetate tracer.  Post-prandial blood samples were analyzed by gas chromatography/mass spectrometry, and DNL calculated by mass isotopomer distribution analysis. Liver fat percentage was determined by magnetic resonance spectroscopy.

Results:DNL during feeding was significantly reduced with fructose restriction, beginning 50 minutes after initiation of tracer/feeding (2.5±0.3 vs.1.6±0.1% on days 0 and 10 respectively, P<0.003 by paired t-test) and continuing throughout the tracer/feeding procedure (13.3±1.2 vs. 5.8±0.6% at 8 hours on days 0 and 10, P<0.001).  Integrated DNL-AUC decreased by 58.7% from 53.5±6.4 on day 0 to 22.1±3.3 on day 10 (P<0.001). The decrease in DNL-AUC over only 10 days of fructose restriction was accompanied by a 29.5% reduction in liver fat from 11.9±2.3% on day 0 to 9.5±2.2% on day 10 (P <0.001; n=20). These effects remained statistically significant after adjusting by ANCOVA for minor weight loss over the 10 days (1.0±0.3 kg, P<0.001).

Conclusions: Isocaloric dietary fructose restriction for 10 days decreased hepatic DNL and liver fat in Latino and African American children irrespective of weight loss. These results suggest that hepatic DNL is an important mechanism leading to liver fat accumulation in children, which can be reversed by short-term fructose restriction. These data support public health efforts to reduce sugar consumption.

Aldosterone mechanism of action is extremely complex, involving several intricate aspects (1) whereby kinetic and cross-talk dynamics appeared to play a critical role in the control of vectorial ionic transport. In this context, an overall assessment of MR genomic targets by new genomic tools was highly desirable. Here, we setup the chromatin immunoprecipitation (ChIP) with a specific anti-MR antibody in a highly differentiated human renal cell line expressing GFP-MR treated or not with aldosterone. This approach coupled with the innovative high-throughput sequencing technology (ChiP seq, HiSeq) allowed identification of hundreds of direct genomic MR targets (MACS Software), including the well known SCNN1A gene coding for the alpha subunit of the epithelial sodium channel (αENaC). Computational analysis of these genomic sites defined a specific MR response element (MRE) in which the AGtACAgxatGTtCt sequence was the most prevalent motif. Of interest, genomic MR binding sites were located at various distances (up to 150 kb) and directions from the transcriptional start sites of target genes. Specific aldosterone-induced recruitment of MR on the first most relevant genomic sequences was further validated by ChIP-qPCR and correlated with concomitant and positive aldosterone-activated transcriptional regulation of the corresponding gene as assayed by RT-qPCR. Analyses of the dynamics of MR recruitment and of its transcriptional co-regulators together with the evaluation of the functional role of these genes in the renal mineralocorticoid signaling pathway are underway.

This work provides new insights into aldosterone, MR-mediated signaling and opens germane perspectives for mineralocorticoid-related pathophysiology.

Glucocorticoids induce insulin resistance in multiple tissues. Systemic glucocorticoid receptor (GR) antagonism improves insulin and glucose homeostasis in ob/ob mice but the site of action is uncertain, with effects confounded by compensatory hypercorticosteronemia. A-348441, a GR antagonist targeted to the liver by conjugation to a bile acid, is used here for the first time to evaluate the role of hepatic GR in the metabolic complications of short-term diet-induced obesity in mice.

Experimental Design

C57BL6/J male and female mice (n = 6-12 per group; age 12 weeks) were given control, high fat (HF, 58% fat, 26% sucrose) or HF with A-348441 (~100mg/kg/day, kindly gifted by KaroBio AB) diet for 4 weeks. Glucose tolerance tests (ip GTT; 2mg/g body weight) were performed after 3 weeks. After 4 weeks, mice were culled (8am). Plasma insulin, non-esterified fatty acids (NEFA), and corticosterone were analyzed using ELISA, and plasma glucose and liver triglycerides (TG) spectrophotometrically. Data are control; HF; HF+A348441, mean±SEM *p<0.05, **p<0.01 vs control; #p<0.05, ##p<0.01 vs HF.

Results

Plasma corticosterone concentrations were not changed in either gender by HF diet or A-348441.

In male mice, A-348441 prevented HF-induced bodyweight gain (31.8±0.5; 34.3±0.5*; 31.1±0.8g#), expansion of the liver (1.47±0.05; 1.66±0.05*; 1.40±0.04g##) and total adipose depot weight gain (1.26±0.07; 2.46±0.14**; 1.58±0.14g##). A-348441 also attenuated HF-induced elevations in fasting plasma insulin (0.83±0.12; 2.06±0.20**; 0.99±0.17ng/mL##), fasting glucose (132.8±7.5; 166.1±8.2**; 125.1±7.0mg/dL##), and insulin response to GTT (91.7±8.2; 261.3±16.3**; 145.2±20.2ng/mL.min##). Neither HF diet nor A-348441 influenced liver triglycerides, fasting plasma NEFA or insulin-mediated NEFA suppression in male mice.

In female mice, HF diet did not significantly increase body or tissue weights, fasting plasma insulin, or post-GTT plasma insulin; A-348441 also had no effect. HF diet did increase fasting and post-GTT plasma glucose, but the only effect of A-348441 was a trend for reduced fasting glucose (113.6±7.5; 164.9±13.5*; 129.6±10.5 mg/dL). HF diet also increased liver TG and decreased NEFA suppression in female mice, but A-348441 did not influence these parameters.

Conclusion

Liver-specific GR antagonism not only improves insulin sensitivity and glucose tolerance in male mice with short-term diet-induced obesity, but also attenuates weight gain. Further dynamic studies are required to assess effects on energy balance and/or liver triglyceride export and its uptake in peripheral adipose. Females were relatively protected from metabolic dysfunction with diet-induced obesity, and GR antagonism had no discernible effect. These results suggest targeting hepatic GR may have a beneficial role in metabolic homeostasis in diet-induced obesity.

PF-04171327 is a non-steroidal ‘dissociated” or partial agonist of the glucocorticoid receptor (DAGR) currently under investigation for anti-inflammatory efficacy, while mitigating unwanted side-effects of glucocorticoids(GCs). Administration of GCs and DAGR is expected to suppress the HPA axis, causing feedback inhibition of cortisol and ACTH secretion. In an 8-week Phase 2b dose-finding study to evaluate the efficacy and safety of DAGR in treating patients with rheumatoid arthritis (RA), 4 doses of DAGR were compared to 2 doses of prednisone (Pred) or placebo (PBO).  The effect of DAGR treatment on HPA axis suppression was evaluated with serial morning cortisol measurements and an ACTH stimulation test. 

Methods

323 adults with active RA therapy were randomized to receive DAGR 1, 5, 10 or 15 mg, Pred 5 or 10 mg, or PBO daily for 8 weeks followed by a 4-week taper. Any use of GCs within 6 weeks of screening was prohibited.  Fasting cortisol levels were measured at each 2-weekly study visit for 8 weeks, and a 250 mcg ACTH stimulation test was performed at Week 13.

Results

Across the dose groups, mean age ranged from 50.4 to 57.4 yrs; proportion of females ranged from 73% to 89.1%; and proportion of Caucasians ranged from 82.6% to 95.6%. Based on aggregate efficacy data, DAGR 10 and 15 mg was found to be efficacious (superior to PBO and comparable to Pred 10 mg, with 20% improvement using the American College of Rheumatology core set measures, and 28-point disease assessment scale, at Week 8). Median suppression of plasma cortisol levels were observed as early as Week 2 with  DAGR 1, 5, 10 and 15 mg doses showing suppression from baseline of  101, 122,  96.4,  110.5 ng/ml by  -14.3%, -79.6%,  -93.7%, -95.3%  respectively; suppression for Pred 5 mg and 10 mg from baseline of 113 and 123 ng/ml by -25.1% and  -42.7%  respectively; and that for PBO  from baseline of 106 ng/ml by  -6.4%. This magnitude of suppression was sustained throughout the 8 weeks of active treatment.  Prompt HPA axis recovery was observed during the 4-week DAGR taper, as morning cortisol levels normalized and a normal response to the ACTH stimulation test was evident in >95% of the patients.  All DAGR doses were well-tolerated, with no clinical manifestations suggestive of adrenal suppression reported.

Conclusions

Profound suppression of plasma cortisol was observed with DAGR 5, 10, and 15 mg, while partial suppression was seen with Pred 5 and 10 mg.  No subjects reported clinical symptoms of adrenal insufficiency at any time.  HPA axis recovery in the taper period was demonstrated by normalization of morning cortisol levels and the ACTH stimulation test. The clinical implications of cortisol suppression by DAGR require further exploration.

Objective: The aim of this study was to determine the frequency of ARMC5 mutations in a large cohort of PBMAH index cases with subclinical or clinical CS. Genotype-phenotype correlation was established.

Patients and Methods: 98 patients with PBMAH were investigated. Leukocytes and/or tumor DNA was genotyped for ARMC5 by Sanger sequencing. Clinical data were collected (age, sex, CS, hypertension). Basal (midnight cortisol level, ACTH, androgens, mineralocorticoids hormones) and post-test parameters (overnight dexamethasone suppression test, ACTH 1-24 stimulation test, and illegitimate receptor responses) were assessed. Computed tomography and histological reports were analyzed.

Results: ARMC5 inactivating mutations were characterized for 24 patients (26%). In total, 36 different mutations were found by the sum of the germline and somatic DNA analysis in addition to one germline microdeletion and somatic losses of heterozygosity. The pathogenic role of the 10 missense mutants and the p.F700del deletion was demonstrated in H295R and Hela cell lines using immunofluorescence staining and flow cytometry. ARMC5 mutants were unable to induce apoptosis unlike the wild-type gene. In addition, 23 patients (23.5%) harbored missense variants which are predicted “benign” by in silico models and previously reported in 1000 genomes and Exome Variants Server databases. These patients and those without variations were considered as wild-type. Seven patients were not included in the comparison because of variants of uncertain significance. ARMC5 mutated patients exhibited more severe CS and were younger than wild-type patients. Overt clinical CS, higher midnight plasma cortisol, lower plasma ACTH and higher plasma cortisol after dexamethasone suppression was observed in the mutated patients. Adrenals of mutated patients were bigger with a higher number of nodules. No mutated patients, but 9 wild-type patients presented with food dependent CS.

Conclusions: More than one quarter of unrelated PBMAH patients present a pathogenic germline ARMC5 defect and these index cases present more severe CS and larger adrenal. Systematic genotyping of ARMC5 may help for early diagnosis of PBMAH, familial counseling, and patients’ management.  

Aim: To build a molecular prognostic predictor, based on tumor DNA alterations, including hypermethylation and mutations of these genes.

Methods:

A cohort of 130 ACCs collected within the COMETE and ENSAT networks were included. Targeted sequencing of 9 genes recurrently altered in ACC (ZNRF3, CTNNB1, TP53, RB1, CDKN2A) was performed by PCR-based capture(LifeTechnologies Ampliseq), followed by next generation sequencing (NGS, LifeTechnologies PGM). Homozygous deletions were identified by SNP arrays (Illumina). CpG island methylation status of each ACC was determined by MS-MLPA (methylation-specific multiplex-ligation-dependent probe amplification), using a commercially available kit (ME002-B1 kit, MRC Holland), and targeting CpGs islands of 4 genes (PAX5, GSTP1, PYCARD, PAX6) previously demonstrated as best reflecting the global methylation status (2); tumors were considered hypermethylated when the mean proportion of methylated alleles was >12% for these 4 genes.

Results:

MS-MLPA showed that 53% of the ACCs were hypermethylated. Hypermethylation was associated with worse survival (Cox p<0.001).

Targeted NGS and SNP arrays showed that mutations and or homozygous deletions of ZNRF3, CTNNB1, TP53, RB1, and CDKN2A were found in 20, 16, 15, 6 and 11 6% of the ACCs respectively. An alteration affecting the Wnt-βcatenin pathway (ZNRF3 or CTNNB1) was observed in 36% of ACCs. An alteration affecting the p53 pathway (TP53, RB1 or CDKN2A) was present in 29%.  Patients with an alteration affecting either the Wnt-βcatenin or p53 pathway presented a worse survival (Cox p=0.019).

Tumors of the poor outcome molecular subtype, defined as the tumors presenting either an hypermethylation, or an alteration of the Wnt-βcatenin or p53 pathways, corresponded to 71% of the cohort. These patients presented a worse survival (Cox p=0.002).

Conclusion:

Tumor DNA can be used to determine the ACC molecular subtype, and therefore the prognosis of ACC patients. This will help to design new prognostic molecular tools.

Methods: This study was a single-blind, placebo-controlled, single center, fixed-sequence, single-dose trial in adult female 21OHD patients.  A total of 8 classic 21OHD females, ages 19 to 58, were administered single doses of NBI-77860 300 mg, 600 mg, and placebo at 2200h during three separate treatment periods separated by a 3-week washout period.  Blood samples were collected over 24-hours to evaluate the pharmacokinetics (PK) of NBI-77860 and the hypothalamic-pituitary-adrenal (HPA) axis biomarkers ACTH, 17-hydroxyprogesterone (17OHP), androstenedione, and testosterone.  The primary analysis of biomarker data was an examination of grouped subject data, for each biomarker, expressed as a mean percent change from predose levels for the two active dosing conditions relative to the placebo condition. 

Results: Plasma levels of NBI-77860 were consistent with previous Phase 1, PK experience with this compound.  There were clinically meaningful reductions from predose levels of both 17OHP and ACTH following administration of NBI-77860 relative to placebo.  The 300 mg and 600 mg doses yielded nearly identical effects on mean percent change from predose in 17OHP and ACTH.  Variable reductions in androstenedione and testosterone levels were observed.  Individual subject responses were also evaluated, and treatment “responders” were conservatively defined as subjects with at least a 50% decrease in 17OHP and ACTH 8-12 hours following NBI-77860 dosing relative to placebo during the peak morning period.  This responder rate, following a single dose, was 50% for the study.  The single bedtime doses of NBI-77860 were well-tolerated in these adult female 21OHD patients.  The overall incidence of adverse events was low and similar among the three treatment conditions. 

Conclusions: Meaningful reductions in HPA axis biomarkers, particularly 17OHP and ACTH, were observed following NBI-77860 dosing in these patients.  These data are promising and provide a rational basis for continuing investigations of the CRF₁ receptor antagonist, NBI-77860, and its activity in reducing ACTH and steroid biomarkers in the target population.  Studying the pharmacodynamics and PK of repeated doses of NBI-77860 will be helpful in this regard.

Calorie restriction (CR) potently suppresses ARC Kiss1 expression and downstream GnRH/luteinizing hormone (LH) release. As we identified GLP-1 as a positive regulator of ARC Kiss1 neurons, we hypothesized that a suppression of CNS GLP-1 action is contributing to reduced ARC Kiss1 action during CR.  First, we found that brainstem Ppg mRNA is reduced following a 48h fast in OVX mice.  However, restoring GLP-1 action using subcutaneous injections of liraglutide, which is known to enter the ARC, did not prevent LH inhibition during a 48h fast in OVX mice. Taken together, these studies demonstrate that GLP-1 is a positive regulator of ARC Kiss1 neurons.  Although suppression of brainstem Ppg mRNA may be contributing to the suppression of ARC Kiss1 and downstream GnRH/LH during CR, restoring GLP-1 action using peripheral injections of liraglutide was not sufficient to prevent LH inhibition during a 48h fast. PPG neurons do not express the GLP-1R, and therefore studies using methods that directly stimulate brainstem PPG neurons will give us a more accurate assessment of whether central PPG activation during CR will prevent LH inhibition. As a whole, more studies are necessary to understand the physiological significance of GLP-1 interaction with ARC Kiss1 neurons.

Kisspeptin and its cognate receptor are expressed within the amygdala, a key limbic brain structure that has important roles in social and reproductive behaviours. In addition, the amygdala exerts an ‘inhibitory brake’ on reproduction via inhibitory projections to hypothalamic centers involved in reproductive hormone release. We therefore hypothesized that kisspeptin affects neuronal activation and reproductive pathways beyond the hypothalamus and particularly within the amygdala.

In a first test of our hypothesis, we mapped brain neuronal activity (using Manganese-Enhanced MRI) in adult rodents during peripheral (ip) administration of kisspeptin. In a second test of our hypothesis we investigated functional relevance in adult rodents by assessing the gonadotrophin response to direct intra-amygdala (MeA) administration of kisspeptin or kisspeptin antagonist.

Peripheral kisspeptin administration resulted in a marked decrease in neuronal activity in the amygdala compared to vehicle (20% decrease left amygdala kisspeptin vs. vehicle p=0.026; 22% decrease right amygdala kisspeptin vs. vehicle p=0.009)(n=7-8/group). This was associated with a simultaneous increase in luteinizing hormone (LH) secretion (vehicle +0.6±0.2ng/ml, kisspeptin +3.7±0.5ng/ml, p<0.0001 vs. vehicle). In addition, direct intra-MeA administration of kisspeptin resulted in a dose-dependent increase in LH secretion (kisspeptin 100pmol vs. vehicle, p=0.007; kisspeptin 1nmol vs. vehicle, p=0.002; kisspeptin 1nmol vs kisspeptin 100pmol, p=0.002)(n=5-7/group). Finally, blocking endogenous kisspeptin signaling specifically within the amygdala by administering intra-MeA kisspeptin antagonist decreased LH secretion (p=0.041 vs. vehicle) as well as LH pulse frequency (p=0.001 vs. vehicle)(n=5-7/group).

Collectively, these data provide the first evidence for a novel pathway in which kisspeptin inhibits neuronal activity in the amygdala, thereby releasing the amygdala’s ‘inhibitory brake’ on reproduction, resulting in stimulation of gonadotrophin secretion and pulsatility. In addition, this is the first report of kisspeptin signaling outside the hypothalamic-pituitary-gonadal axis influencing reproductive hormone secretion. Therefore, these data have important implications for our understanding of reproductive biology, as well as the development of kisspeptin as a therapeutic.

The hypothalamic neuropeptide kisspeptin is a key regulator of GnRH and thus gonadotropin (LH and FSH) secretion. Gonadotropin response to exogenous kisspeptin is increased in the late follicular phase, suggesting a central role of kisspeptin in mediating pre-ovulatory positive estrogen feedback. We hypothesised that exogenous kisspeptin, administered concurrently with appropriately timed estrogen, would further increase gonadotropin secretion, mimicking the physiological mid-cycle surge.

Methods

We used a model of follicular phase administration of transdermal estradiol (200µg/day) to induce positive feedback and increase LH secretion 48 hr later. Eight women with regular menstrual cycles received this regimen on cycle day 9-10 and at 24 hr were randomised to receive kisspeptin-10 (4µg/kg/hour iv) or saline infusion for 7 hours, at the end of which estradiol treatment was discontinued. All women returned in a subsequent cycle to receive the alternate treatment allocation.  Hormone concentrations were compared by ANOVA with Bonferroni multiple comparison post hoc analysis.

Results

Model Validation

In control (saline infusion) cycles, estradiol increased from 302±39 pmol/l pre-administration to 744±98 at 24 hr after patch administration (p<0.0001); and after removal of estradiol patches at 32 hr fell to 351±83 pmol/l at 48 hr. LH increased after 48hr but not 24hr of estradiol treatment (time 0: 4.3±0.6; 24 hr: 3.2±0.3; 48 hr: 8.5±1.2 IU/l, p=0.0007). FSH initially fell during estrogen treatment, then increased significantly after 48hr in the saline group (time 0: 2.6±0.3; 24 hr: 1.8±0.3; 48hr: 3.4±0.6 IU/l, p=0.005).

Kisspeptin Response

Kisspeptin-10 acutely stimulated LH secretion, from 3.8±0.6 to 18.1±4.7 IU/l (p<0.0001) at the end of infusion, while saline had no effect (3.2±0.3 to 2.7±0.3 IU/l, ns). LH remained significantly elevated at 48 and 72 hr after the start of estrogen treatment (16.4±4.4 and 8.5±1.4 IU/l, both p<0.01 vs start of infusion); at those time points LH concentrations were similar to the estrogen-stimulated concentrations in the control group.

Kisspeptin-10 also acutely increased FSH secretion: from 1.7±0.1 IU/l pre-infusion to 3.9±0.6 IU/l post-infusion (p<0.001) while saline had no such effect (1.8±0.3 to 1.3±0.2 IU/l, ns). FSH remained elevated following kisspeptin-10 at 48 and 72 hr (4.0±0.5 and 3.8±0.3 IU/l, both p=0.0001) and was similar to FSH concentrations in controls.

Conclusions

Kisspeptin-10 amplified the positive feedback effect of estrogen with substantial LH secretion in this model of estrogen-induced gonadotropin secretion in women.  Notably, kisspeptin-10 also increased FSH secretion. These data suggest a central role for kisspeptin signalling in mediating the positive estrogen feedback which facilitates the ovulatory midcycle surge in gonadotropin secretion.

Funding: Wellcome Trust-STMTI

Objective: We examined LH secretory dynamics in male and female patients with lipodystrophy, on and off exogenous leptin therapy.

Methods: This was a 2 period, non-randomized study, including previously leptin-treated (n=4) and leptin-naïve (n=8) subjects (5 generalized lipodystrophy; 7 partial lipodystrophy).  In period 1 (5 days) the leptin-treated group continued leptin; leptin was withdrawn for the next 14 days (period 2).  Leptin-naïve subjects were studied without leptin in period 1, and with leptin replacement in period 2. Nocturnal LH secretory dynamics were assessed [23:00-7:00, q10 min sampling, analyzed by multiparameter deconvolution and approximate entropy (ApEn) algorithms] at the end of each period. Early morning follicle stimulating hormone (FSH), estradiol (E2), and total testosterone (T) were measured at the end of each period.

Results: There were no period effects between patients initiated or withdrawn from leptin, so data were analyzed in aggregate. Mean (on: 5.0 ± 3.1 U/L, off: 3.2 ± 1.3, p=0.02) and integrated nocturnal LH concentrations (on: 2403 ± 1495 U·L^-1·min^-1, off: 1534 ± 642, p=0.02) were higher on leptin therapy. LH burst frequency (on: 0.77 ± 0.26 hr^-1, off: 0.67 ± 0.24, p=0.04) and secretory burst mass (on: 9.7 ± 15.4 U/L, off: 7.0 ± 11.2, p=0.04) were higher on leptin. Consequently, leptin therapy increased pulsatile production rate (on: 64 ± 101 U·L^-1·8hr^-1, off: 57 ± 73, p=0.01) but not basal secretion of LH (on: 20 ± 27 U·L^-1·8hr^-1, off: 21 ± 30, p=0.48). Orderliness of LH release (ApEn) tended to be higher on leptin therapy (p=0.09). FSH tended to be higher on leptin (on: 6.0 ± 6.2 U/L, off: 4.4 ± 3.9, p=0.05). In males (n=4), T was higher on leptin (on: 507 ± 286 ng/dL, off: 360 ± 174, p=0.04), and in females (n=8), E2 was higher on leptin (on: 74 ± 36 pg/mL, off: 29 ± 24, p=0.01).

Discussion: Leptin increases spontaneous nocturnal LH secretion in patients with lipodystrophy. This is consistent with rodent and in vitro studies showing a direct stimulatory effect of leptin on LH secretion. Increased LH frequency suggests additional hypothalamic effects. These novel findings may explicate some of the salutary effects of leptin therapy on the hypothalamic-pituitary-gonadal axis in patients with lipodystrophy.

Clinical Case: Two siblings, an 11-year-old girl (P1) and a 7-year-old boy (P2), presented with postnatal growth failure (height -6.0 SDS) and dysmorphic features. They were born with severe IUGR (birth weight and length: -6 SDS) to healthy consanguineous short Yemenite parents (mother’s height, 145cm; father’s height, 160cm). A moderate delayed bone age and epiphyseal abnormalities were noted. Severe microcephaly (head circumference, -7 SDS), mild intellectual disability, deafness, congenital cardiac malformations, oligodontia and enamel hypoplasia, and a partial vermis hypoplasia (brain MRI) were also documented in both patients. Endocrine evaluations revealed normal basal growth hormone, elevated IGF1 and normal IGFBP3 concentrations. Fasting glucose levels were normal, although OGTT (2hr) for P1, was in the diabetic range, with elevated glucose (216, normal:70-110 mg/dl), insulin (66.5, normal:5-25 mcU/ml) and c-peptide (9.8, normal:1.1-3.6 ng/ml) levels, consistent with insulin insensitivity. P2 produced a disturbed glucose tolerance OGTT profile. Molecular evaluation by exome sequence analysis identified a novel homozygous, deletion of 12 nucleotides (exon 10) in the IGF1Rgene, which generated an in-frame p.A711_E714del. Functional analysis by fluorescence-activated cell sorting (FACS) of live primary fibroblasts derived from the patients demonstrated normal expression and cell surface localization of the mutant IGF1R. IGF-I-induced signal transduction, however, was significantly reduced, but not abrogated.

Conclusion: Homozygous IGF1R mutations identified to date do not completely ablate IGF1R expression/functions. Severe pre- and postnatal growth failure, mild intellectual disability, microcephaly and dysmorphic features were pronounced compared to patients with heterozygous IGF1R defects. These features, together with congenital cardiac anomalies and marked insulin insensitivity, support critical roles of IGF1R in human development and maintenance of glucose homeostasis, mechanism(s) to be elucidates.

Aim of the study: To study the genetic defects underlying infantile gigantism and acromegaly.

Patients and methods: We performed genomic and genetic studies in patients with gigantism (n=46), and then sequenced an implicated gene in an international cohort of acromegaly patients (n=248). In vitro functional studies were performed in rat somatomammotrope GH3 cells to assess the role of an identified genetic variant.

Results: We detected by array-CGH a novel microduplication at chromosome Xq26 in two unrelated kindreds and twelve sporadic cases of various ethnic origins with infantile gigantism (n=16; 11 females). Two smallest regions of overlaps (SRO) were shared by the duplications; breakpoint junctions characterization revealed microhomology, suggesting a replicative mechanism for formation. The common duplicated genomic interval extends for approximately 500 Kb and contains four protein-coding genes. Only one of these genes, encoding a G-protein coupled receptor (GPCR) that strongly activates the cAMP signaling pathway was consistently over-expressed in patients’ pituitary lesions both at the RNA and protein level. We identified a recurrent variant in this gene in 4% of patients with acromegaly, mostly in tumors, whereas no pathogenic mutations were observed in the other three genes located within the SRO. When transfected into GH3 cells the mutation led to increased GH secretion and cell proliferation.

Conclusions: We describe a previously unrecognized genomic disorder caused by Xq26 microduplication (X-LAG for X-linked acro-gigantism) and characterized by early-onset gigantism resulting from GH excess that can be transmitted as a dominant trait. The gene is a GPCR that is dosage-sensitive and over-expressed in patients’ pituitary lesions; it activates the cAMP pathway, whose mitogenic effects in pituitary somatotroph cells are well established; and a recurrent mutation is found in patients with sporadic acromegaly.

G.T. and A.F.D. share the first authorship; A.B. and C.A.S. share the senior authorship of this abstract

Objectives: To identify gene clusters and pathways linking growth and metabolic response in children with growth hormone deficiency (GHD) treated with recombinant human growth hormone (r-hGH).

Methods: Pre-pubertal children with GHD (n=125) were enrolled from the PREDICT short-term (NCT00256126) and long-term follow-up prospective study (NCT00699855). Whole blood gene expression (GE) was determined prior to treatment with r-hGH. One year height velocity (HV) and 1 month change (Δ) in IGF-I on r-hGH were used as clinical markers of growth response; Δ of serum fasting glucose, insulin, triglycerides, LDL and HDL levels were used as clinical markers of metabolic function; the relationships between these variables were identified by partial correlation. Associations were made with basal GE using rank regression (p<0.05). The GE overlap (p<0.05) between clinical markers was used to construct network models and identify gene clusters. Clusters were ranked using their network centrality score (Moduland algorithm) to define associated biological functions (hypergeometric test with Benjamini-Hochberg false discovery rate modification, q<0.05). Causal network analysis (CNA), mapping known literature to the network models, was performed to identify master regulators of GE (Ingenuity Pathway Analysis).

Results: Six paired correlations of clinical markers were identified (p<0.05); HV with ΔIGF-I, HV with ΔLDL and ΔIGF-I/HDL/triglycerides/glucose (individually) with Δinsulin. The intersection between the network models defined by these correlations identified five clusters of genes that linked growth and metabolism. These clusters were associated with adipogenesis, cell cycle checkpoint control and AMPK/mTOR signaling pathways (q<0.001) linked to the master regulators RXR, PLK1 and TSC1, respectively (p<0.001).

Three genes associated with the network models were found in the overlap of the GE correlated with the markers HV, ΔIGF, ΔLDL and ΔInsulin: SPTBN1, RRBP1 and UGGT2. These genes are putative functional markers of the metabolic response to r-hGH and have been previously associated with adult height, obesity and insulin sensitivity.

Conclusions: This study has identified network models, biological pathways and genomic markers linking growth and metabolic response to r-hGH therapy in GHD children.

 Type B insulin resistance due to autoantibodies to the insulin receptor is characterized by diabetes refractory to massive doses of insulin, hypercatabolism resulting in dramatic weight loss, severe hyperandrogenism, and widespread acanthosis nigricans.

The 10 year mortality rate is 54%. In the present study we show the continued efficacy of combination therapy for type B insulin resistance.

 Trial design

 Inclusion criteria– patients with type B insulin resistance confirmed by the presence of insulin receptor antibodies.

 Study design- The patients underwent routine hematological, immunological, and biochemical testing at baseline and in regular intervals during the treatment. The treatment protocol consisted of:

-          Rituximab750 mg/meter body surface area iv in two consecutive doses 2 weeks apart, repeated every 3-4 months if the disease persisted

-          Cyclophosphamide 100 mg po daily continuously until remission was achieved

-          Dexamethasone 40 mg po  daily for 4 days or methylprednisolone 1 g iv for 2 days, repeated  every 3-4  weeks if the disease remained active

-          Once patients achieved remission- maintenance therapy with azathioprine 100 mg daily.

Primary endpoints - remission was defined as the amelioration of the hyperglycemia and discontinuation of insulin therapy and/or normalization of hyperandrogenemia.

Results

Seventeen patients fulfilled inclusion criteria – 14 women and 3 men with mean age of 38.4+/-17.6 years.

The underlying autoimmune background consisted of mixed connective tissue disease in 6/17 patients, lupus in 8/17 patients, Sjogren disease in 1 patient, uveitis in 1 patient and undetermined in 1 patient.

Mean baseline fasting glucose level was 307.5 +/-149 mg/dl, mean HgbA1c 11.3+/- 2.7%, mean baseline insulin level 1428+/-1708 mcU/ml (normal (N) 6.0-27.0), c-peptide 4.8+/-3.9 ng/ml (N 0.9-7.1), average daily insulin requirements ranged between 200 and 19000  units per day, mean total testosterone 463+/-346 ng/dl (N 8-60 for female patients), androstendione 374.4+/-426 ng/dl (N 30-200), total cholesterol 134.6+/-36.4 mg/dl, LDL 58.9+/-36.4 mg/dl, HDL  64+/-20.13 mg/dl, triglycerides 57.13+/-20.13 mg/dl. 

14/17 patients achieved remission after a median 5.5 months of therapy (range 2.5-27.25 months) as documented by normalization of fasting glucose (mean 88.8+/-26.8 mg/dl), HgbA1c (mean 6.1+/-2%), decreased to zero insulin requirements and normalization of testosterone levels to105.3+/-29.25 ng/dl and androstendione to 105.7+/-113 ng/dl. Three patients have yet to achieve remission had been treated most recently for only 1 to 5 months. During the course of the follow up (median 65 months), 2/17 patients developed disease recurrence with hyperandrogenemia, but again responded to combination therapy.

Conclusions

This standardized approach represents a personalized targeted therapy that is effective in this most extreme form of diabetes.

Methods:  In a T1D cohort of 645 youth and young adults followed for a median of 12.9 years (interquartile range 9.1-16.5), 212 (33%) had hyperlipidemia (LDL ≥130 mg/dl) and underwent detailed chart review. Clinical data, lab results, and provider management recommendations were extracted from 3,222 encounters. Analyses included assessment of patterns of persistent hyperlipidemia, effectiveness of provider recommendations, and acceptance and adherence to lipid-lowering treatments (Rx).  Comparisons of LDL levels before and after provider recommendations were assessed by T test.

Results:   At baseline, youth (37% male) were 16.0±4.8 years old with T1D duration 9.2±5.1 years, A1c 9.9±2.0%, and LDL 149±22 mg/dl. Over a mean of 13.2 years of follow-up, providers appropriately noted LDL elevations in 80.6% of encounters when LDL ≥130 mg/dl. In 51 of youth, ≥50% of subsequent LDLs continued to be ≥130 mg/dl.  To lower LDL, providers commonly recommended improving glycemic control (30% of encounters); dietary changes (24% of encounters); enhancing exercise (16% of encounters); and starting, changing, or reinforcing adherence with Rx (11% of encounters).  Only Rx advice yielded improved LDL levels at subsequent visits (mean improvement of 26.9±51.5 mg/dl vs 10.9±35.5 mg/dl in those without Rx, p=.008).  In our sample, 67 individuals (32%) were eventually started on Rx, and 22 (10%) (n=22) refused Rx. Rx was started after a median of 4 elevated LDLs (interquartile range 2-7) and 3.6 years (interquartile range 0.8-8.8 years), and at a mean age of 20.5±4.4 years. After starting Rx, 61% of youth continued to have 50% or more of subsequent LDLs ≥ 130 mg/dl.

Conclusions:  Youth with T1D frequently have hyperlipidemia. Provider recommendations for lifestyle do not produce major improvements in LDL levels. While Rx is effective, initiation is often delayed, titration inadequate, and patient acceptance limited.  Changes in clinical practice are needed to improve management of hyperlipidemia in youth and young adults with T1D.

At 26 T1D Exchange pediatric diabetes treatment  centers, 140 adolescents 12-19 years old (mean±SD 15.3 ± 1.7 years ) with T1D duration >1 year (7.0± 3.3 years), body mass index (BMI)  ≥ 85^th percentile for age and gender (94± 4^th %), total daily insulin dose ≥0.8 units/kg (1.1 ± 0.2 units/kg) and HbA1c 7.5%-9.9% (8.8%± 0.7%) were randomly assigned to either metformin (maximally tolerated dose 1000-2000 mg/day) or placebo for 6 months, in addition to their basal/bolus insulin therapy.  The primary outcome was change in central lab- measured HbA1c after 26 weeks. 

Baseline HbA1c was 8.8% in each group.  At 13 weeks, change in HbA1c from baseline in the metformin group (-0.2%±0.8%) was significantly better than placebo (+0.1%±0.8%, p=0.02). However, this differential effect was not sustained at 26 weeks where mean change in HbA1c from baseline was +0.2%± 0.8 in the metformin group and +0.2%± 0.9 in the placebo group (p=0.92).   At 26 weeks, a 25% or more reduction from baseline in total daily insulin per kg of body weight was achieved by 23% of the metformin group compared with 1% of the placebo group (p=0.003); 24% of the metformin group and 7% of the placebo group had a reduction in BMI z-score >10% from baseline to 26 weeks (p=0.01).    Differences in body composition measures by DEXA scan also favored the metformin group at 26 weeks. More participants in the metformin group reported gastrointestinal adverse events (70% vs. 35%, p<0.001) and at least one severe hypoglycemic event defined as cognitive impairment requiring assistance to treat (8% vs. 0 events; p=0.03).

Six months of adjunctive metformin therapy does not improve glucose control for overweight adolescents with T1D, but does reduce insulin requirements and BMI.

Methods:Twenty nine patients with suspected DFO underwent CEMRI, ¹⁸F- PET, FDG-LL PET/CT. Patient's plasma was obtained for autologous leukocytes and labelled with 314.5–555 MBq (8.5– 15 mCi) of ¹⁸F-FDG. Bone biopsy was considered gold standard for  the diagnosis of DFO. A lesion localized to a bony structure on FDG-LL PET/CT corresponding to clinically suspected site along with ¹⁸F-PET/CT uptake was classified as true positive for osteomyelitis, and as a soft-tissue infection if it did not involve the bone. Increased ¹⁸F-Flouride uptakes in periarticular areas or underlying multiple bones with or without that of adjacent soft tissues were labeled as acute on CN.

Results: FDG-LL PET/CT showed increased tracer uptake [SUV (max) 8.4±4.7] at clinically involved site in 10 patients who had bone biopsy-proven DFO (true positive). No abnormal labeled leukocyte localization was observed in three patients with biopsy-positive infection (false negative). 10 subjects with suspected osteomyelitis had no abnormal uptake on FDG-LL PET/CT and bone cultures were sterile (true negative). There was no false positive on FDG-LL PET/CT study. CEMRI identified 9 out of 13 cases of osteomyelitis and was false positive in 6 cases. The sensitivity and specificity of concurrent ¹⁸F-Flouride and FDG-LL PET/CT is 83.3% and 100% compared to 81.8% and 45.5% of CEMRI, respectively, for the diagnosis of DFO on the background of CN of foot.

Discussion and conclusions: CEMRI had poor specificity for the diagnosis of DFO on background of CN as it relies on identification of marrow edema for diagnosing bone infection, which could be of non-infective etiology like Charcot’s neuroarthropathy.  [18F]-2-fluoro-2-deoxy-D-glucose (FDG)  as the radiotracer  is a non-specific indicator of increased intracellular metabolism compared to ¹⁸F-Flouridewhich has affinity for bone. The present study shows high accuracy of ¹⁸F-Flouride PET/CT with FDG-LL PET/CT for the diagnosis of osteomyelitis in diabetic CN of foot. Patients showing  PET/CT localization of labeled leukocytes may be spared of bone biopsy.

Two global, double-blind, Phase III trials (ROMANA 1, NCT01387269, N=484; ROMANA 2, NCT01387282, N=495) assessed ANAM efficacy/safety in patients with unresectable stage III/IV NSCLC and cachexia (≥5% weight loss within prior 6 months or BMI <20 kg/m²). Patients were randomized (2:1) to receive daily oral ANAM (100 mg) or placebo for 12 weeks. Co-primary endpoints were change from baseline over 12 weeks in LBM (measured by DXA) and in hand grip strength (HGS). Secondary endpoints included change from baseline in the anorexia-cachexia domain of the Functional Assessment of Anorexia/Cachexia Treatment (FAACT). Hunger was evaluated using an exploratory Hunger Assessment Scale. Post-hoc analyses evaluated additional body composition parameters from DXA, including total body mass (TBM) and FM.

Over 12 weeks, ANAM significantly increased LBM vs placebo in both studies (p<0.0001). In ROMANA 1, median change in LBM was 1.10 kg (95% CI 0.76; 1.42) for ANAM vs -0.44 kg (95% CI -0.88; 0.20) for placebo; similarly, changes in ROMANA 2 were ANAM 0.75 kg (95% CI 0.51; 1.00) vs placebo -0.96 kg (95% CI -1.27; -0.46). Post-hoc analyses on additional DXA parameters revealed that ANAM significantly increased TBM vs placebo at week 12 in both studies (median changes from baseline of 2.87 vs 0.07 kg, p<0.0001; and 2.04 vs -0.59 kg, p<0.0001). This change was driven by LBM gains, but also included significant increases in FM vs placebo (median changes from baseline of 1.21 vs -0.13 kg, p<0.0001; and 0.77 vs 0.09 kg, p=0.012). Changes in HGS were not statistically different between treatment arms. In both studies, ANAM significantly improved FAACT anorexia/cachexia domain scores vs placebo (mean changes of 4.12±0.8 vs 1.92±0.8; p=0.0004; and 3.48±0.9 vs 1.34±1.0; p=0.0016). Mean changes at week 12 in the Hunger Assessment scores for ANAM vs placebo were 0.93±1.9 vs 0.47±1.8 in ROMANA 1 and 1.00±2.3 vs 0.60±2.4 in ROMANA 2. The most frequent drug-related adverse event (AE) for the ANAM arm in both ROMANA 1 and 2 was hyperglycemia (5.3% and 4.2%), and both studies had few drug-related grade ≥3 AEs in the ANAM arm (0.9% and 2.7% vs 1.2% and 2.5% in the placebo arm).

ANAM for 12 weeks was well tolerated in two global, large-scale, Phase III studies. In both studies ANAM significantly increased LBM and FM, suggesting a restoration of energy balance. Also, ANAM significantly improved patients’ symptoms and concerns related to anorexia-cachexia.

We studied 50 women with abdominal obesity before and after randomization to GH (n=28) or placebo (n=22) administration for 3 mos. Bioactive IGF-1 was measured by a kinase receptor activation assay; relative IGF-1 bioactivity was expressed as “% bioactive IGF-1” [(bioactive IGF-1/total IGF-1) x100]. Body composition was assessed by DXA and insulin resistance by OGTT.

Prior to treatment, visceral adipose tissue (VAT, r= -0.39, p=0.006) and insulin resistance (OGTT glucose area under the curve) (r= -0.46, p=0.001) were negative determinants of bioactive IGF-1; peak GH on glucagon stimulation testing was not a determinant. VAT (r=0.29, p=0.04) was a positive determinant of % bioactive IGF-1, demonstrating a relative preservation of IGF-1 bioactivity with visceral adiposity. GH treatment resulted in an increase in total IGF-1 (144 ± 56 to 238 ± 75 ng/mL, p<0.0001), IGF-1 z score (-1.6 ± 0.5 to -0.4 ± 1.1, p <0.0001), absolute IGF-1 bioactivity (1.29 ± 0.39 to 2.60 ± 1.12 ng/mL, p<0.0001), and a trend toward an increase in % bioactive IGF-1 (1.00 ± 0.45 to 1.14 ± 0.43%, p=0.06).  The increase in absolute IGF-1 bioactivity with GH administration predicted an increase in lean mass (r= 0.31, p=0.03), decrease in VAT (r= -0.33, p=0.03) and increase in fasting glucose (r= 0.41, p=0.005). In contrast, there was no association between increase in total IGF-1 and any variable. The increase in % bioactive IGF-1 with GH treatment was associated with an increase in insulin resistance [OGTT 2H glucose (r= 0.38, p=0.05)] and a decrease in trunk fat (r= -0.54, 0.004) over 3 mos. 

In conclusion, bioactive IGF-1 is inversely associated with abdominal fat and insulin resistance in obese women. Percent bioactive IGF-1 is higher in obese women with more VAT, driven by lower total IGF-1. With GH administration, increases in absolute IGF-1 bioactivity, but not total IGF-1, predict changes in body composition. Moreover, % bioactive IGF-1 increases in parallel with increasing insulin resistance, despite a reduction in abdominal fat. Our data suggest that GH treatment increases absolute bioactive IGF-1 and % IGF-1 bioactivity in parallel with increased insulin resistance. In turn, GH may modulate body composition in obesity through increases in bioactive, not total, IGF-1.

Here we present an RNAseq analysis of human bone samples, obtained from iliac crest needle biopsies, to yield the first in vivo interrogation of all potential genes and pathways that may be altered in bone with aging and E deficiency in humans.  60 healthy women were studied, including 20 young women (mean age ± SD, 30.0 ± 5.4 yrs) as well as 40 old women (n = 20 per group) randomized to receive either no therapy (72.9 ± 6.5 yrs) or 3 wks of short-term estrogen (STE) therapy (70.5 ± 5.2 yrs).  Using fairly stringent criteria (median count ≥ 10, P ≤ 0.05, false discovery rate [q] ≤ 0.10), 678 genes were altered with aging including 446 up- and 232 down-regulated genes, respectively (in old vs young subjects).  In bone tissue, aging significantly altered a total of 60 pathways (all P < 0.05), including a subset known to regulate bone metabolism such as Notch, PTEN, HIF1α, and Wnt/β-catenin signaling.  Interestingly, a large number of the identified pathways and genes were previously unrecognized as changing in bone with aging.  Perhaps unexpectedly, many of these pathways and genes have critical functions in other tissues and disease processes, although their role(s) in the pathogenesis of skeletal fragility requires additional investigation.  Notably, SOST levels did not change with aging, but STE therapy tended to lower SOST levels in bone (P < 0.001; q = 0.46).  Importantly, these changes in gene expression mirrored findings in serum (using the MSD sclerostin assay).  Further, in old women, of the 21 unique genes altered in bone by STE, the expression of INHBB (encoding for activin), which markedly decreases with aging (P < 0.001, q < 0.001), is restored to young adult levels in a robust manner (P < 0.001, q < 0.001) in response to E therapy.

In conclusion, our findings demonstrate that aging alters a substantial portion of the skeletal transcriptome, whereas STE therapy appears to have significant, albeit less wide-ranging effects.  To date, our results provide the most comprehensive assessment of the effects of aging and E therapy on the skeleton’s gene expression profile, and serve as a valuable resource for the identification of novel biomarkers associated with age-related bone loss to better target therapies to specific patients.

Objective: To determine if known GWAS-implicated adult bone density loci interact with PA to modify the association between PA and BMD and bone mineral content (BMC) in childhood.

Design/Methods: We used a six-year prospective observational study design and all participants were of European ancestry, enrolled in the Bone Mineral Density in Childhood Study (N=689, 52.4% female). The following outcomes were estimated by dual energy X-ray absorptiometry: femoral neck (FN), total hip (TH) and spine areal BMD (aBMD), and total body less head (TBLH) BMC, Z-scores corrected for height and age. DNA was extracted from blood/saliva and genotyped using high-throughput technology; we investigated 77 single nucleotide polymorphisms (SNPs) near adult BMD susceptibility loci identified through GWAS. The participants self-reported their PA levels (hr/d) and trained clinicians measured puberty stage (Tanner I, II-IV and V). Interaction effects of PA with each SNP and with both puberty stage and each SNP were examined by sex using linear mixed models. Age, BMI, and dietary calcium were adjusted in these models.

Results: PA exhibited statistical interactions with 30 loci (P<0.05) and 20 loci exhibited statistical interactions with both PA and puberty stage (three-way interaction, P<0.05) to influence aBMD/BMC. For example, SNP rs4283041 near ERC1/WNT5B interacted with PA to influence TBLH-BMC in males (P=1.1x10^-4); each hr/d of PA was associated with higher TBLH-BMC Z-score for CC homozygotes (b=0.04, P=3x10^-7); similar findings were observed for spine, TH and FN aBMD.  SNP rs7195617 near AXIN1 interacted with PA to influence total hip aBMD in females (P=3.9x10^-4); each hr/d of PA was associated with higher TH aBMD Z-score for females carrying one or more G alleles (GG homozygotes: b=0.06, P=4x10^-5); similar findings were observed for FN and spine aBMD. The strongest three-way interactions were observed for spine aBMD in males (rs17691610 near MAPT, P=3.6x10^-4) and in females (rs7304170 near KLHDC5/PTHLH, P=4.3x10^-4). In females, carrying one or more rs7304170 C alleles was associated with increased spine aBMD during Tanner V (CC homozygotes: b=0.15, P=0.002).

Conclusions: PA was associated with higher aBMD/BMC, but this association was dependent on genetic variation at certain known bone density loci. Our data suggests that not all childhood skeletons respond equally to PA. These findings are particularly important for children born into families with a history of osteoporosis; increasing PA in childhood may not always be an efficacious approach to help prevent later osteoporosis.

Endocrine pancreatic tumors (p-NETs) occur with an incidence of 0.4 to 1 in 100,000. Insulinomas confine the largest group of p-NETs. Somatic mutations in MEN1 have been found in up to 20% of sporadic p-NETs. Recently, a hot spot mutation was found in the Ying Yang 1 gene in 30% of insulinomas. The YY1 gene can act either as a tumorsupressor or an oncogene in other tumours such as breast, prostate and colorectal cancer. The mutation (YY1 T372R) was associated with a later onset of insulinomas. 

Material and methods: 

Benign sporadic insulinomas (n=39) were snap frozen after surgery. DNA was extracted, subjected to PCR and subsequent automated Sanger sequencing of YY1 and MEN1. 

Oral glucose tolerance test (OGTT) was performed before the surgery. Fischer exact test and the Mann-Whitney-U-test were used for statistical analysis.

Results:

We found the YY1 T372R mutation in 28% (11/39) of the tumours, mutually exclusive from mutations in MEN1 found in 13% (5/39). The median age of patients with tumour harboring YY1 mutation was 63.0 ± 13.4 years and 45.5 ± 17.2 years in in those without YY1 mutation (p=0.03). There was no significant difference in sex, or the extent of the tumors. OGTT could not show any significant differences between the two groups 36 ±11.5 (mg/dl) in the YY1 mutated group and 41 ± 15.3 (mg/dl) in those without YY1 mutation, (p=1.00) The maximum suppressed insulin value at symptomatic hypoglycemia was 13.4 ± 14 (mU/L) versus 18,2 ± 21,7 (mU/L) p=0.61.

There was no significant difference concerning the time until hypoglycemia of <45 (mg/dl) was achieved in the OGTT test (5 hours versus 4 hours, p=0.15). 

Conclusion:

In accordance to the previously published data, we found the YY1 T372R mutation in 28.2% of  the analyzed sporadic benign insulinomas. We demonstrated a significantly later onset of insulinomas harboring YY1 mutation. Pathophysiological symptoms in the patients investigated by OGTT were not correlated to mutation status. Further investigations are warranted to determine the biological behavior of insulinomas with the YY1 T372R mutation.

Objective: Determine the prevalence and characteristics of pancreatic neoplasms in MAS.

Patients and Methods:  Thirty patients (aged 7 to 67 years, median 18.5) in the National Institutes of Health cohort of subjects with MAS underwent abdominal MRI and magnetic resonance cholangiopancreatography (MRCP) screening for pancreatic neoplasms.  Identified IPMNs were further categorized according to the 2012 International Consensus Guidelines into those with either high risk or worrisome features; including main duct dilatation ≥5 mm, cysts ≥ 3 cm, mural nodule, thickened wall or solid component, jaundice secondary to the cyst or history of acute pancreatitis.

Results: Nine patients (30%) had pancreatic abnormalities.  Eight of these patients had cystic lesions of the pancreas; one with simple cysts and seven with IPMNs.  Five of the seven IPMNs exhibited worrisome or high-risk stigmata.  IPMN subtypes included the following: one main pancreatic duct IPMN, three branch duct IPMN and three mixed- IPMN.  The median age of patients with pancreatic pathology was 47 (range 17 to 67).  Three patients had pancreatic divisum, including 2 of the subjects with IPMNs. None of them had evidence of exocrine dysfunction. Surprisingly, 5 of the 9 subjects with pancreatic pathology (55%) were diagnosed with diabetes.  The mean BMI and ages were 29 and 33. The mean BMI and age of onset of type 2 diabetes in the general population are 37 and 45, respectively.  <5% of the remaining >170 subjects in the NIH MAS cohort have diabetes   

Conclusions:  Gastrointestinal neoplasms, particularly IPMNs, appear to occur more frequently and at a younger age in patients with MAS compared to the general population. This suggests that pancreatic neoplasms are a clinical feature of MAS.  Given the malignant potential of IPMNs in the general population, screening for pancreatic neoplasms in patients with MAS may be warranted.  Further determination of the natural history and spectrum of IPMNs in MAS is needed. Finally, the unexpected high rate of diabetes in subjects with MAS and anatomical pathology warrants further investigation.

Methods. The presence of the TSH-Receptor (TSH-R) on various cells was established using Western blot analysis. BioNanofluid was conjugated to TSH-R antibody (Ab), purified TSH (Thyrotropin) and recombinant TSH (Thyrogen) through covalent amide bonds to create 3 different types of conjugates. A laser at 532nm was used to illuminate cells for set exposure times. Cell death was assessed using trypan blue staining.

Results. BCPAP, a PTC cell line was TSH-R positive, while NSC-34, a hybrid neuronal mouse cell line was TSH-R negative. A 2:1 BCPAP cell:conjugate ratio and 30 second exposure time eliminated ~60%, 65% and >70%  of the BCPAP cells when using TSH-R Ab, Thyrotropin and Thyrogen conjugates, respectively, with minimal non-targeted killing. Increasing conjugate ratios and longer exposure (40 seconds) yielded higher targeted cell killing rates; however, more than 30% non-targeted killing in the BCPAP Unconjugated BioNanofluid control group was observed, suggesting bulk heating. NSC-34 (control) cell killing was less than 10% under all conditions. With engineered improvement of nanoparticles, chemistry and ligand presentation, targeted killing rate exceeded 90% with ~10% non-specific cell death.

Conclusion. A BioNanofluid platform offering a potential therapeutic path for PTC has been investigated, offering an alternative for more complicated patients, who currently undergo suffering caused by reoperative neck exploration, repeated administration of radioactive iodine (RAI), external beam radiation or chemotherapy. In addition, BioNanofluid treatment may serve as an alternative to RAI therapy, directed at both PTC cells and normal thyroid tissue. This work represents one demonstration of BioNanofluid therapeutic development, where targeted physical therapy can overcome the challenge of tumor heterogeneity.

Methods: Single-center, open-label, Phase I, DDI study in healthy adult volunteers. On study day 1 volunteers received a single dose of probe substrates (cocktail approach; caffeine [100 mg], omeprazole [20 mg], dextromethorphan [30 mg], and midazolam [2 mg]), followed by PK assessments over the next 48 h. After a 6-day washout period, subjects then received a single dose of osilodrostat 50 mg (planned therapeutic dose range 2–30 mg bid), followed 0.5 h later with a single dose of probe substrates. PK assessments were conducted over the next 48 h.

Results: 10 males and 10 females with an overall mean age, body weight, and body mass index of 41.8 years, 72.95 kg, and 24.4 kg/m² were enrolled. One subject discontinued (withdrew consent). AUC_last geometric mean ratio (GMR) and 90% confidence intervals (90% CI) of probe substrate exposure with osilodrostat administration were 2.33 (2.10–2.59), 1.91 (1.74–2.11), 1.48 (1.34 –1.63), and 1.50 (1.41–1.60) for caffeine, omeprazole, dextromethorphan and midazolam, respectively. Corresponding values for AUC_∞ GMR (90% CI) were 2.54 (2.34–2.75), 1.86 (1.61–2.15), 1.54 (1.40–1.69), and 1.50 (1.41–1.59). C_max GMR (90% CI) for the change in substrate exposure was 1.07 (0.988–1.15), 1.61 (1.40–1.84), 1.35 (1.21–1.50), and 1.47 (1.32–1.62) for caffeine, omeprazole, dextromethorphan and midazolam, respectively.

Osilodrostat is a moderate inhibitor of CYP1A2 and CYP2C19 (exposures of the respective probe substrates increased ~2.5- and 2-fold, respectively) and a weak inhibitor of CYP2D6 and CYP3A4 (exposures of the respective probe substrates increased ~1.5 fold).

Conclusions: Considering that a 50 mg single dose of osilodrostat is reasonably representative of the upper end of the daily drug exposure expected for clinical use (maximum 30 mg bid), it is encouraging that the most clinically important CYP enzyme, CYP3A4, was only weakly inhibited. As most patients with Cushing’s disease in a Phase II study achieved normal urinary free cortisol levels with ≤10 mg bid osilodrostat, osilodrostat is unlikely to have a clinically relevant impact on the exposures of other medications cleared by CYP3A4.

Methods: At baseline, of 151 evaluable enrolled patients, 93 (62%), were fully controlled (IGF-1 < 1 ULN and integrated GH < 2.5 ng/mL); 41 subjects (27%) were partially controlled with IGF-1 levels between 1 – 1.3XULN and GH < 2.5 ng/mL; and 17 subjects (11% ) were not controlled. 86 subjects (57%)  were previously treated with high doses of parenteral SRLs (Octreotide LAR® ≥30mg/month or Lanreotide Autogel®=120mg/month), and 65 were previously treated with   low to mid doses of injectables (LAR 10 or 20mg or Autogel 60 or 90mg).   In this descriptive analysis we studied the relationship between pre-study SRL dose (post hoc), or baseline disease activity (pre-defined), to OOC efficacy up to 13 months. The correlation between prior SRL dose and oral octreotide dose was also studied.

Results:The degree of baseline control while on injectable SRLs predicted subsequent OOC response. Respective OOC response rates were 76 % (full baseline control), 66% (full or partial baseline control) and 24% (uncontrolled at baseline). Previous injectable SRL dose also predicted OOC response. 72% of subjects previously treated with low to mid SRL doses responded to OOC vs.  56% response for subjects previously treated with high doses. Full biochemical control at baseline and low to mid doses of prior injectable SRLs yielded 85% response on OOC (49 of 58 subjects). The OOC dose distribution in all enrolled subjects was shown to be related to prior injectable SRL dose. While 74% of subjects previously treated with low SRL doses required 40mg OOC, 31% of subjects treated with high SRL dose were controlled by 40 mg OOC. 110 subjects were initially controlled on OOC following dose titration, and entered a fixed dose phase (average 12 weeks from first OOC dose). At the beginning of the fixed-dose phase, 51, 25 and 34 subjects were treated with OOC 40, 60 and 80mg respectively. Initial response to low to mid doses of OOC predicts sustainable response over time as the response up to 13‑months was 88, 84, and 47% for each respective OOC dose.

Conclusions: High dose injectable SRL or partial baseline control portend favorable efficacy to OOC. Full baseline biochemical control, and/or low to mid injectable SRL dose requirements portend  higher OOC response rates. OOC was effective in a subset of patients, uncontrolled at baseline while on injectable SRLs. OOC efficacy can reliably be determined within 12 weeks of initiating therapy and its effect is sustainable for up to 13 months.

Pegvisomant (PEGV) is a competitive antagonist of growth hormone (GH) approved for the treatment of patients with acromegaly. The recommended starting dose of PEGV is 10 mg/day, and doses are titrated upwards until normalization of serum levels of insulin-like growth factor-I (IGF-I) is attained. The purpose of this analysis was to evaluate data from ACROSTUDY, a Pfizer-sponsored non-interventional post marketing study on the long-term outcomes of pegvisomant therapy, on the clinical characteristics of patients who required PEGV at a daily dose above 30 mg/day for IGF-I normalization and to compare these with the characteristics of patients who attained IGF-I control with a PEGV dose of 10 mg/day.

Methods:

All data available as of June 2014 were included in this analysis. Baseline was defined as start of PEGV. IGF-I was measured at various local labs and expressed as IGF-I /upper normal level (ULN).  A normal IGF-I was defined as an IGF-I/ULN below 1.2. All patients treated for at least six weeks with a PEGV at a dose above 30 mg/day who had two consecutive normal IGF-I values were included in the “High” group (H). Patients who had two consecutive normal IGF-I values and who never received treatment with a dose of PEGV above 10 mg/day were included in the “Low” group (L). Descriptive statistics are expressed as mean (±SD).  Significance level was set to 5%.

Patients:

56 patients (39% males) with a mean (SD) age of 43.6 (13.0) yrs at PEGV start in H and 368 patients (46% male) with a mean age of 51.9 (14.6) yrs (p<0.05) yrs in L were included in the analysis.

Results:

At baseline 84% of H and 77% of L was treated before with surgery and 29% of H and 26% L had received radiotherapy. Time since diagnosis of acromegaly was 6.3 (8.9) yrs and 8.6 (9.0) in H and L respectively (p<0.05).  Of 6 clinical symptoms (arrhythmia, diabetes mellitus, hypertension, osteoarthritis, sleep apnea, surgery for carpal tunnel syndrome) collected in ACROSTUDY, hypertension and sleep apnea, were more frequent in the H group. At baseline 27% and 44% (p<0.05) were on long-acting somatostatin analogs and 18% and 11% were on dopamine antagonists in H and L resp. IGF/ULN at baseline was 2.8 (1.3) and 1.4 (0.7) (p<0.05) in patients in whom IGF-I levels were available (82% in H and 71% in L). The mean starting dose of PEGV was 16.6 (12.9) mg/d in H and 8.8 (2.4) mg/day in L (p<0.05). Duration of PEGV treatment was 6.9 (2.5) yrs in H and 4.4 (2.5) yrs in L (p<0.05). Duration of treatment with a dose >30 mg was 3.5 (2.0) years. IGF/ULN at the end of follow up was 1.0 (0.5) in H and 0.8 (0.4) in L (p<0.05).

Conclusion:

Data from ACROSTUDY suggest that the group of subjects that need high daily doses of PEGV to normalize their serum IGF-I levels have a higher incidence of hypertension and sleep apnea and higher baseline values of IGF-I, which might suggest that they have a more severe form of acromegaly.

Aim and Methodology: Here we describe pregnancies in a large cohort of patients with hypopituitarism and investigate potential factors determining pregnancy outcomes. All pregnancies reported in KIMS (Pfizer International Metabolic Database), pregnancy outcomes and complications, as well as their relationship to use of GHRT during pregnancy were analyzed with simple and multiple regression methods. Significance level was set to 5%.

Results: A total of 201 pregnancies were reported from centers in fifteen countries, 173 in female patients aged 22-43 years (preliminary data on 115 shown at ENDO12), and 28 in partners of male patients. Ninety percent of female pregnant patients had at least one additional pituitary deficiency and two-thirds of women underwent fertility treatment in order to achieve pregnancy. GHRT was stopped before pregnancy in 7.5% of the female patients, as soon as pregnancy was confirmed in 40.1%, and at the end of the second trimester in 24.7% of the patients, while 27.6% of the female patients continued GHRT throughout pregnancy. GH treatment patterns during pregnancy were not related to the etiology of pituitary disease, extent of pituitary deficiencies or conception method. Birth of a healthy child was reported in 79% of the female pregnancies.  Non-elective abortions occurred mainly in the first trimester, and one fetal malformation (cystic hygroma) was diagnosed in the second trimester. Regression analyses performed to identify parameters related to pregnancy outcomes showed that they were not related to GHRT treatment patterns, IGF-I SDS (last before pregnancy), method of conception or number of additional pituitary deficiencies. Negative pregnancy outcomes were associated with a history of depression and with maternal age at conception below 30 or above 35 years. Pregnancy-associated complications were not related to GHRT during the pregnancy.

Conclusion: These data on pregnancies in a large cohort of women with hypopituitarism receiving GHRT reveal different treatment patterns across countries. Of note is the large number of patients requiring assisted reproductive techniques, extending beyond ovulation induction/ovarian stimulation, indicating that successful reproduction in women with pituitary deficiency often requires more than adequate hormone replacement therapy. In the clinical practice setting, nearly all patients taking GH replacement continue treatment during the time when they seek fertility, and more than half remain on treatment (fully or partially) during the pregnancy. Based on the current data, growth hormone replacement regimens during pregnancy do not appear to affect pregnancy outcomes.

We assessed the incidence of new malignant neoplasia in adults on GHRT with GHD caused by a malignancy or its treatment enrolled in KIMS (Pfizer International Metabolic Database). Childhood onset (CO) and adult onset (AO) cancer survivors (CS) were compared to patients with CO idiopathic GHD (IGHD) and with AO non-functioning pituitary adenoma (NFPA), respectively.

We compared 349 CO-CS (176 f, age at disease onset 10.4 yr, age at adult GHRT start 24.5 yr, BMI 26.6 kg/m², IGF-I SDS -2.4) with 619 IGHD (221 f, age at disease onset 9.0 yr, age at adult GHRT start 28.8 yr, BMI 24.9 kg/m², IGF-I SDS -3.4). CO-CS composition: germ cell tumor (112), medulloblastoma (68), astrocytoma (53), glioma (49), leukemia or lymphoma (47), nasopharyngeal tumor (10), chordoma (3), sarcoma (7). Radiotherapy was used in 69% of CO-CS. After a mean 5.2 yr GHRT (3908 patient-years), 3 new malignant neoplasias were observed in IGHD (1 leukemia, 1 breast cancer, 1 melanoma) with a Standardized Incidence Ratio (SIR) of 0.47 (95% CI, 0.09-1.37). After a mean 4.0 yr GHRT (2192 patient-years), 16 CO-CS developed a new neoplasia (7 non-melanoma skin cancer (NMSC), 6 malignant brain neoplasia, 2 cervix uteri cancer, 1 papillary thyroid cancer). The overall SIR for CO-CS was 10.39 (95% CI, 5.93-16.87) and 6.52 (95% CI, 2.97-12.37), excluding NMSC.

We compared 174 AO-CS (74 f, age at disease onset 30.1 yr, age at GHRT start 36.0 yr, BMI 29.4 kg/m², IGF-I SDS -1.4) with 2449 NFPA (933 f, age at disease onset 46.6 yr, age at GHRT start 53.2 yr, BMI 28.9 kg/m², IGF-I SDS -1.0). AO-CS composition: germ cell tumor (59), leukemia or lymphoma (35), astrocytoma (29), glioma (18), nasopharyngeal tumor (13), medulloblastoma (9), chordoma (7), sarcoma (4). Radiotherapy was used in 59% of AO-CS and 34% of NFPA. After a mean 4.1 yr GHRT (1024 patient-years), a new malignant neoplasia occurred in 3 AO-CS (liver cancer, prostate cancer, malignant histiocytosis) SIR 1.11 (95% CI, 0.22-3.24). After a mean 5.3 yr GHRT (15215 patient-years), NFPA patients developed a new malignant neoplasia in 153 cases (34 skin lesions, 35 prostate cancers, 13 lung cancers). The SIR for AO-NFPA was 1.05 (95% CI, 0.89-1.23).

This study shows an increased risk of second malignant neoplasia in CO-CS but not in AO-CS within the time frame of this study. This illustrates the need to follow CO-CS patients for longer time periods, especially when previously irradiated.

Materials and Methods: from February 2000 to March 2004, 174 of 260 consecutive cystic thyroid lesions were included in the study. Enrolment criteria were:  a. baseline volume > 5.0 mL; b. fluid component > 50% ; c. relapse after complete drainage; d. normal thyroid function; e. repeat benign cytology. Eighty-six patients (33%) were not eligible because of indeterminate or suspicious cytology, large multinodular goiter, or thyroid hyperfunction. Cyst volume at baseline was 5 - 10 mL in 51%, 10 - 20 mL in 27%, and > 20 mL in 22% of cases. Fluid content was > 75% in 56% and 50 - 75% in 44% of the cases. The following parameters were evaluated after the baseline drainage: characteristics of fluid content, rapid refilling after aspiration, uni or multilocular structure. Treatment was performed, according to the previously described technique, by injection under US monitoring of a volume of 95% ethanol corresponding to 50% of the drained fluid. At the 1 month control, a second treatment was performed in case of a fluid relapse > 30%. Clinical and US controls were performed at 1 and 6 months, and at 1, 5 and 10 years.

Results: Mean volume decrease was -38,2% at 1 month (p=0.05), -52,1% at 6 months (P=0.04), -57,5% at 1 year (p=0,03), -56,9% at 5 years (p=0,04) and -56,4% at 10 years (p=0,04). After 10 years volume reduction was -60,8% in cysts <10 mL (p=0,04),  -59,5% in cysts 10 - 20 mL (p=0,01) and 49,3% in cysts >20mL (p=0,02). Ten-year volume reduction was significantly greater in cysts with a fluid content > 75% than in those < 75% (81% vs  51%, respectively; p=0.01). The most favourable outcome was observed in unilocular cysts with > 75% colloid content and the worst in multilocular cysts with 50-75% fluid component and rapidly refilling hemorrhagic content. No changes of thyroid function or autoimmunity were observed. The procedure was described as well tolerated in 94% of cases. Two minor complications were registered during 229 procedures (0.8%): one self- resolving neck hemathoma and one temporary dysphonia. No malignancies were observed during the follow-up period.

Conclusions: PEIT induces a rapid and long-lasting reduction of the volume of benign cystic thyroid lesions. Favourable predictive factors are a fluid content > 75%, unilocular structure and no rapid refilling after drainage. PEIT should be considered as the first line treatment for prevalently cystic benign thyroid nodules.

The effects of pharmacological HDAC inhibition by valproic acid (VPA 0.5-1.5mM) were investigated in an ex vivo murine embryonic thyroid organ culture model. Undifferentiated thyroids were microdissected at embryonic day 13.5 (E13.5), and analyzed at day 3 and 7 (E13.5+3d and +7d) of culture by HDAC activity assay, immunohistochemistry, morphometry, and flow cytometry (FACS).

The effect of HDAC inhibition by VPA 1.0mM induced the following epigenetic changes at E13.5+3d: First, general HDAC activity decreased significantly by 45% vs. control. Second, we observed by FACS a significant epigenetic switch on the histone tail mark H3K9 from trimethylation (H3K9me3) to acetylation (H3K9ac) compared to control in the complete thyroid as well as in the epithelial (EpCAM+), endothelial (CD31+) and mesenchymal (PDGRFalpha+) subpopulations. HDAC inhibition resulted in disturbed thyroid differentiation: By immunohistochemistry VPA treated organs showed 1) significantly lower BrdU+ cells, 2) lower number of blood vessels, and 3) decreased follicle number. These results were quantified by FACS and morphometry. By FACS, we observed at E13.5+7d a significantly decreased number of BrdU+ epithelial and endothelial cells while the number of BrdU+ mesenchymal cells did not change. As a consequence, absolute cell numbers of epithelial and endothelial cells decreased significantly (-57% and -79%, respectively) at day 7 of culture, while the mesenchymal cell mass remained constant. Morphometric analysis revealed a significant and dose dependent decrease of follicle numbers in VPA treated thyroids.

Our results show that normal HDAC activity levels are critical for growth, angiogenesis and follicle formation during thyroid differentiation in the mouse and suggest a putative new molecular mechanism for thyroid dysgenesis in the human.

Participants and Methods: Maternal serum TSH and FT4 levels were determined between pregnancy week 9 and 18, and child IQ was measured at median age 6 years in 3839 mother-child pairs from the Generation R study, an iodine sufficient population. All analyses were adjusted for hCG, TPO-antibody positivity, gestational age, maternal age, parity, smoking, ethnicity, education level, child gender and birth weight. Additionally, in a subset of mother-child pairs (N=2460) child TSH and FT4 levels at birth and at time of IQ measurement were available.

Results: There was a strong and independent, U-shaped association between maternal FT4 levels and child IQ (P=0.003). A similar association with the risk of borderline intellectual functioning (defined as IQ <85) was present (P=0.003).
We performed sensitivity analyses which investigated the maternal FT4 threshold value for significantly decreased mean child IQ levels. Low FT4 levels at or below the 8^th percentile were associated with a significantly decreased mean child IQ (range -2.1 to -3.8 points; P≤0.01). For high FT4 levels, mean child IQ levels were significantly decreased at or above the 89^th percentile (range -2.0 to -3.8 points; P≤0.01).
TSH levels were also associated with child IQ levels (P=0.04), but this was driven by their reflection of FT4 levels and thus not independent (P=0.37 after adjustment). Results remained unchanged after correction for hCG levels or child TSH and FT4 levels.

Conclusions: This is the first study to show that maternal FT4 levels during early pregnancy are continuously associated with child IQ levels in a U-shape manner. According to our sensitivity analyses, brain development during early life may be affected by maternal FT4 levels in up to 19% of all children. Because high FT4 levels have similar detrimental effects as low FT4 levels, L-T4 treatment aiming for high-normal thyroid function tests may not be completely without risks. 

Methods:  A computerized database of a large health care organization (Clalit Health Medical Organization) was reviewed.  All cases of known thyroid disease or cases in which thyroid medications were dispensed were excluded.  Patients older than 65 years evaluated in the years 2002-2012 (end of follow-up 31.12.12) with documented normal free T4 values were included in the analysis and were divided into 3 groups based on TSH values: normal (normal TSH), scH (TSH > 4.2 mIU/L) and scHy (TSH <0.35 mIU/L). Long term Mortality HR was compared between the three groups and a sub analysis according to TSH values was performed in those with scH and scHy.

Results:  Final analysis was performed on 17,440 individuals with subclinical thyroid disease {538 scHy (3.1%), 1956 scH (11.2%), normal 14,946 (85.7%) , average age 83±6.5 years} who were followed-up for 10 years.  Both scH (HR= 1.75 CI 1.63-1.88) and scHy (HR= 2.33 CI 2.08-2.63) were associated with significantly increased mortality that persisted on multivariate analysis for age, gender, chronic kidney disease, chronic obstructive lung disease, smoking, dementia, Parkinson's disease, cerebrovascular disease, congestive heart failure, diabetes mellitus and hypertension (scH HR=1.68 CI 1.56-1.8, ScHy HR=1.93 CI 1.7- 2.17 ).  TSH values > 6.35 mIU/L were associated with the highest mortality in those with scH, whereas in scHy, no threshold for increased mortality was identified.

Conclusions:  Both scH and scHy are associated with increased mortality in the elderly. A threshold TSH value (>6.35 mIU/L) exists for increased mortality in scH, but not in scHy.

Methods:Using data from the UMHS Post-Bariatric Surgery Program, we performed a retrospective analysis to compare weight loss and change in BP, BMI, A1C, lipids, blood indices as well as common vitamin levels between surgeries. Serum creatinine was evaluated as an indirect marker of lean mass. Data were collected at baseline and 2, 6, 12, and 24 months (m) post-surgery. This analysis does not include the early (30-day) post-operative period and the data on immediate surgical complications. Changes between time points and baseline were compared between groups by the Wilcoxon rank sum test. Results are reported as mean±SE.

Results: Data from 392 patients post-GB (age 44±1 years, 81% females) and 337 patients post-SG (age 45±1 years, 77% females) who had their surgeries at our institution from 1/1 2008 to 11/20/2013 were included. To date, 269 GB and 203 SG patients completed 12m follow up and of these 186 GB and 89 SG had 24m follow up. At baseline, BMI and weight were significantly lower in the GB group compared to the SG group (47.2±0.4 kg/m² and 133±1 kg vs. 49.8±0.5 kg/m² and 141±2 kg, p<0.0001). GB experienced greater and more rapid weight loss: GB group lost 68.6±2.6 % of excess body weight by 12m vs. 55.0±1.4 % noted in SG group (p<0.0001). This difference was preserved at 24m (65.6±4.1% vs.52.0 ±2.2 %, respectively, p<0.0001). HbA1C improved in both groups with a decrease of 1.40±0.2% following GB and 0.75±0.15% following SG (p =0.01 at 12m). The GB group displayed a fall in serum creatinine that reached statistical difference at 2m and sustained for long-term while the SG group experienced a less remarkable decrease in serum creatinine (0.10±0.01 mg/dL following GB vs 0.04±0.01 following SG, p<0.0001 at 12 m). Both groups had a fall in Hemoglobin (Hb) at 2m, with GB patients displaying significantly greater fall compared to SG (1.14±0.08 g/dL vs. 0.71±0.07 g/dL, p= 0.0002). The fall in Hb was not protracted and improved back to baseline by 6m. We did not observe a significant difference with respect to circulating B12 or Vitamin D levels at baseline or longitudinally; however, patients completing studies especially at later time points were not sufficient to conclude on true differences between the two groups.

Conclusions: Our data demonstrate greater weight loss and metabolic improvements in patients undergoing GB when compared to SG after 2 years. GB patients experienced a larger decrease in Hb within the first two months, and a sustained decrease in creatinine. A consideration of immediate surgical complications and prospective longitudinal data are required in order to truly assess risks and benefits of SG and GB.

Individuals (BMI ≥27 kg/m² with ≥1 comorbidity, or ≥30 kg/m²; 78.5% female, 61.2% with prediabetes, 45.1 yrs, body weight 106.2 kg, BMI 38.3 kg/m² [all means]) were randomized 2:1 to receive once-daily liraglutide 3.0 mg (n=2487) or placebo (n=1244), both as adjunct to 500 kcal/day deficit diet and increased physical activity (≥150 min/week). Changes in fasting (FPG) and postprandial plasma glucose (PPG) (determined during an oral glucose tolerance test; OGTT), were assessed at baseline and week 56. Hypoglycemic events were reported as adverse events (AEs), by individuals based on symptoms (spontaneous, not biochemically confirmed) between visits, or by investigators based on glucose values ≤70 mg/dL during visits (including OGTT), irrespective of symptoms (paleness, shaking, sweating, increased pulse/heartbeat, hunger, vision disorder, unusual behavior or drowsiness).

From baseline to 56 weeks, greater reductions were seen with liraglutide vs placebo in body weight (-8.0% vs -2.6%), FPG (-7.1 mg/dL vs. 0.1 mg/dL) and PPG (-46.8 mg/dL vs -10.4 mg/dL) [observed means LOCF; p<0.0001, ANCOVA]. Improvements in glycemia were more pronounced in individuals with prediabetes than without.

No hypoglycemia AEs required third-party assistance. Similar proportions of individuals on liraglutide (1.3%) and placebo (1.0%) reported hypoglycemia based on symptoms between visits. More individuals with liraglutide vs. placebo had biochemical hypoglycemia AEs during FPG visits (3.6% vs 0.8%) or OGTT (8.3% vs 1.4%), consistent with the observed effects of liraglutide on FPG/PPG. Of biochemical events reported during FPG and OGTT visits, respectively, 31.3% and 41.5% with liraglutide vs. 30.0% and 33.0% with placebo were asymptomatic. As expected with the glucose dependency of liraglutide, only a small proportion of events reported at visits were associated with PG <56 mg/dL; a more clinically relevant threshold for hypoglycemia in individuals without T2D (FPG visits: 0.1% vs 0%, OGTT visits: 2.3% vs 0%, for liraglutide and placebo, respectively). Overall hypoglycemia AEs were less common in those with prediabetes than without (liraglutide: 9.4% vs 15.9%; placebo 2.6% vs 4.3%, respectively), consistent with a higher mean baseline FPG and PPG.

In conclusion, in overweight and obese individuals without diabetes, liraglutide 3.0 mg, as adjunct to diet and exercise, was associated with greater reductions in fasting and postprandial glucose compared with diet and exercise alone. Clinically significant hypoglycemia with glucose <56 mg/dL was rare with both treatments.

Few studies have followed prospectively the long-term outcome of gastric bypass surgery in children and adolescents. In morbid obese adults, gastric bypass improves significantly cardiovascular profiles and the weight loss obtained is maintained over several decades. Here we present five-year data from the prospective non-randomized controlled study; Adolescent Morbid Obesity Surgery study (AMOS) using laparoscopic Roux-en-Y gastric bypass (LRYGB).

Methods

Eighty-one young pubertal non-syndromic obese adolescents (13.0 to 17.9 years of age, Tanner stage >3) underwent LRYGB. Inclusion criteria was BMI >40 or >35 with co-morbidities. Follow up visits were scheduled at one, two and five years post-surgery. Body composition was examined with DEXA (Lunar). A group of BMI and age matched adolescents were identified in a national registry and were assessed after five years. A BMI and gender matched adult group (35-45 years of age) undergoing LRYGB was also followed prospectively.

Results

Mean inclusion BMI was 45.5 kg/m² in young surgically treated (YST), 42.2 kg/m² in adolescent controls (AC) and 43.5 kg/m² in adult surgically treated (AST). At five years postop, BMI of YST was 32 kg/m² (total weight loss 27%, p<0.001) while BMI of AC was 43 kg/m² (gained 10% in weight) and 31 of AST (weight loss 29%, p<0.001). In YST, waist circumference decreased from 134 to 98 cm (p<0.001) and body composition changes included a reduction in the percentage fat mass (51.8% to 40.9%, p<0.0001) as well as a relative increase in lean mass (47.0% to 56.8%, p<0.0001) over the two post-surgery years. Boys lost more fat mass than girls (-17.3% vs. -9.5%, p<0.0001). Fasting insulin in YST decreased from 32 to 7 mU/L the first post-surgery year and continued unchanged low during two and five years post-surgery, whereas levels in AC were above 30 mU/L (p<0.001). The same pattern was seen for supersensitive CRP, which decreased significantly in YST from 7.2 mg/L to 2.5 the first year post-surgery. 

Conclusion

Laparoscopic gastric bypass appears equally effective in adolescents as in adults regarding weight loss and metabolic improvements up to five years after surgery.  There seems to be substantial gender difference in changes in body composition, with increased loss of fat mass in males. If this has an implication on differences in long-term metabolic outcomes between genders merits further evaluation.

Methods: A sample of NO (BMI percentile <95^th %) and OB (BMI percentile ≥95^th %) children ages 5.5- 15y were prospectively enrolled for longitudinal investigation. Age- and sex-specific BMI percentiles were calculated according to CDC 2000 standards. Skeletal age was assigned using the Greulich and Pyle atlas and predicted adult height (PH) was calculated according to the Bayley-Pinneau tables. Participants were followed to near-final adult height (FH) as determined by age / skeletal age >14y for girls; >15.5y for boys).

Statistics:The primary analysis was ANCOVA, with the difference between PH and FH (PH-FH) as the dependent variable, and age, sex, race, obesity status, and the sex * obesity status interaction as independent variables.

Results:A total of 191 patients (mean age 9.3±1.8 y; 52.9% female and 47.1% male; 60.2% white, 37.7% black, 2.1% Asian) were enrolled and followed to FH.  At baseline, the mean bone age was 9.9±1.9y; 50% were prepubertal and 34% were obese.  There were no statistically significant differences between the NO and OB groups in sex, race, or mid-parental target height. At baseline, the OB children were younger than NO (8.7±1.4 vs. 9.5±1.8y, p=0.002) but the bone age relative to chronological age was significantly greater among the OB group (+1.5±1.1 vs. +0.3±0.9y, p<0.0001) and height SD score was significantly greater in the OB group (+1.45±0.97 vs. +0.29±0.99, p<0.0001).  Final adult height was documented at mean age 19.9 ±3.2y. In ANCOVA, PH-FH was significantly predicted by sex, age, and the interaction between sex and obesity status. Among obese girls FH was significantly underestimated by PH (-2.3±1.1, CI -4.5 to -0.08cm, p=0.035); however, among obese boys, FH appeared to be overestimated by PH (+2.4±1.2, CI -0.01 to +4.7cm). Among non-obese children, there were no significant differences found between FH and PH.

Discussion: In a large pediatric cohort enriched for obesity, followed prospectively to adult height, obese children were initially taller and had advanced skeletal age, consistent with adipose tissue aromatase action increasing circulating estrogens. Surprisingly in obese girls, despite their tendency to have earlier onset of puberty, FH was underestimated, while in obese boys, who generally show a delayed entry into gonadarche, FH showed a trend towards being overestimated by the Bayley-Pinneau method. These data suggest the Bayley Pinneau tables for predicting adult height using skeletal age may need to be revised to take into account obesity.

Aim: To determine the effects of bariatric surgery on the long-term risk of microvascular and macrovascular events in obese patients without diabetes at baseline.

Methods: The Swedish Obese Subjects (SOS) study is a prospective matched intervention study conducted at 25 surgical departments and 480 primary healthcare centers in Sweden. Participants were 37 to 60 years of age, and BMI was 34 or more in men and 38 or more in women. The current analyses included 3429 patients in the SOS study that did not have diabetes at baseline. Of them, 1658 patients underwent bariatric surgery (19% banding, 69% vertical banded gastroplasty, 12% gastric bypass) and 1771 obese matched controls given usual care. Microvascular (eyes, kidneys and peripheral nerves) and macrovascular (legs, heart and brain) events requiring hospital or specialist outpatient treatment or that were associated with death during follow-up were traced by searching the Swedish Cause of Death Register and the Swedish National Patient Register. Median follow up time was 18 years.

Results: Bariatric surgery reduced the incidence of microvascular plus macrovascular events, whichever came first, in patients without diabetes at baseline (566 and 411 events in the control and surgery groups, respectively; HR=0.73; 95%CI: 0.64-0.82; P<0.001). When the incidence of microvascular and macrovascular events were analyzed separately, both were reduced in the surgery group compared to controls (HR=0.48; 95%CI:0.38-0.60; P<0.001 and HR=0.80; 95%CI:0.70-0.92; P<0.002 for microvascular and macrovascular events, respectively). The reduction of the incidence of microvascular plus macrovascular events was more pronounced in patients with prediabetes at baseline compared to those with normal glucose status (HR=0.52; 95%CI: 0.40-0.68; P<0.001 and HR=0.79; 95%CI: 0.68-0.91; P<0.001, respectively; interaction P-value=0.005).

Conclusion: Bariatric surgery reduced the long-term risk of diabetes-associated vascular disease in obese patients without diabetes at study start.

This subgroup analysis compares efficacy and safety in responders (weight loss of ≥5% from baseline at week 56) vs non-responders. Changes from baseline data are least-squares means (efficacy) or observed means (safety) with LOCF. Pulse data are observed means for completers.

Mean weight loss for responders vs non-responders was 10.3% vs 1.6% with liraglutide 3.0 mg, 10.4% vs 1.3% with liraglutide 1.8 mg and 9.7% vs 0.7% with placebo, although more individuals in the liraglutide 3.0 mg (49.9%, n=205) and 1.8 mg (35.6%, n=72) groups than the placebo group (13.8%, n=29) were responders (p<0.0001).

Changes in A1c from baseline with liraglutide 3.0 mg, 1.8 mg and placebo were -1.6 and -1.5 vs -1.1% for responders, and -1.0, -1.0% and -0.2% for non-responders. SBP was reduced by -5.0, -6.2 and -5.3 mmHg in responders with liraglutide 3.0 mg, liraglutide 1.8 mg and placebo respectively and -0.5, -1.9 and 0.5 mmHg in non-responders. Physical function scores using IWQoL-LITE improved by 19.0, 16.4 and 15.5 with liraglutide 3.0 mg, liraglutide 1.8 mg and placebo, respectively, in responders vs 11.1, 10.4 and 7.7 in non-responders.

In responders vs non-responders adverse events (AEs) were reported by 96% vs 92% with liraglutide 3.0 mg, 96% vs 90% with liraglutide 1.8 mg and 94% vs.85% with placebo. For serious AEs no marked differences between responders and non-responders were observed. The most frequent AEs were GI disorders, which were more frequent in responders vs non-responders for liraglutide 3.0 mg (76% vs 55%) but not different for liraglutide 1.8 mg (58% vs 57%) or placebo (41% vs 39%). Rates (events/patient year) of documented symptomatic hypoglycemia (plasma glucose ≤56 mg/dL) were similar in responders vs non-responders across all groups, liraglutide 3.0 mg: 0.9 vs 0.8; liraglutide 1.8 mg: 0.8 vs 1.1; placebo: 0.1 vs 0.3. Mean (SD) change in pulse rate from baseline for liraglutide 3.0 mg, liraglutide 1.8 mg and placebo was 1.3 (9.5), 2.0 (10.7) and -4.4 (10.1) bpm for responders and 3.5 (10.2), 3.1 (10.1) and -1.2 (9.0) bpm for non-responders.

In conclusion, a higher proportion of individuals achieved a clinically meaningful ≥5% weight loss at 56 weeks with liraglutide 3.0 mg and 1.8 mg, compared with placebo. The responder groups had a total weight loss at 56 weeks of approx 10%. Responders in the liraglutide groups had greater improvements in A1c, indicating an additional benefit of treatment above that attributed to weight loss. Similar overall incidence of AEs was observed in subgroups.

In 40 healthy premenopausal women (37 ± 8 yrs; BMI 20-39 kg/m²) with normal BMD by DXA and no history of fracture, we measured body composition by DXA; Tb BV/TV, microstructure and BFR/BS on tetracycline-labeled bone biopsies; and serum IGF-1, sclerostin, bone turnover markers (BTM), HDL, TG, and calculated LDL on fasting morning serum.

As expected, LDL (±SD: 100 ± 25 mg/dL) and TG (87 ± 53 mg/dL) were directly and HDL (50 ± 15 mg/dL) inversely related to BMI and DXA trunk fat. HDL was directly related to Tb BV/TV (r=0.40; p=0.01) and BFR (0.40; p=0.01). We compared 23 women with HDL <50 mg/dL, the metabolic syndrome cutoff, to 17 with normal HDL (63 ± 11 mg/dL). BMI (27.8 ± 4.9 vs 23.0 ± 2.3 kg/m²) and %DXA trunk fat (36 ± 8 vs 27 ± 8) were higher in the low HDL group (both p<0.001). Age, BMD, HOMAIR, serum glucose, PTH, 25-OHD and reported exercise did not differ. The low HDL group had significantly lower BV/TV (21.0 ± 7.3 vs 27.3 ± 6.8%; p=0.009) and Tb thickness (148 ± 36 vs 179 ± 32 µm; p=0.008), and lower BFR (0.006 ± 0.004 vs 0.012 ± 0.008 mm²/mm/yr; p=0.01) and serum markers of resorption (C-telopeptide, 214 ± 78 vs 386 ± 241 pg/mL; p=0.01) and formation (osteocalcin, 13 ± 5 vs 19 ± 10 ng/mL, p=0.04; and PINP, 42 ± 11 vs 53 ± 23 µg/L, 0.07). The low HDL group also had significantly lower IGF-1 (168 ± 40 vs 206 ± 65 ng/mL; p=0.03) and higher sclerostin (0.50 ± 0.19 vs 0.36 ± 0.10 ng/mL; p=0.01), both potential mediators of the detrimental relationship between fat and bone. Relationships between HDL and Tb BV/TV and BFR were unaffected by controlling for reported exercise but no longer significant after controlling for DXA trunk fat.  Relationships between HDL and Tb BV/TV remained significant after controlling for serum IGF-1 (0.38; p=0.018) and sclerostin (0.33; p=0.046). Relationships between HDL and BFR remained significant after controlling for serum IGF-1 (0.36; p=0.029) but were attenuated (0.28; p=0.093) by controlling for sclerostin.  

In summary, healthy premenopausal women with HDL levels consistent with the definition of metabolic syndrome (< 50 mg/dL) were distinguished by significantly lower Tb bone formation and bone volume on bone biopsies. We conclude that HDL is an easily measured marker of excess VAT that may identify young women at risk for poor bone health for studies of the skeletal effects of interventions that promote weight loss or increase exercise.

Methods: Vertebral CSA, vertebral height, and intervertebral disc height were measured from the sixth thoracic to the fifth lumbar vertebrae using magnetic resonance imaging (MRI) in 70 healthy full-term newborns (35 male and 35 female). Additionally, measures of the length and CSA of the humerus, musculature, and adiposity were obtained.

Results: Weight, body length, head and waist circumferences, and MRI measures of musculature and adiposity did not significantly differ between sexes (all P’s ≥ 0.060). Compared to newborn boys, girls had significantly smaller vertebral cross-sectional dimensions (1.465 ± 0.11 vs. 1.309 ± 0.12; P < 0.0001) – a disparity that was independent of gestational age, birth weight, and body length. In contrast, sexes were monomorphic with regard to vertebral height, intervertebral disc height, and spinal length (all P’s ≥ 0.108). There were also no sex differences in the length or cross-sectional dimensions of the humerus (both P’s ≥ 0.151).

Conclusions: Factors related to sex influence fetal programming of the axial skeleton. The smaller vertebral CSA in females is associated with greater flexibility of the spine that could represent the human adaptation to fetal load. Unfortunately, it also imparts a mechanical disadvantage that increases stress within the vertebrae for all physical activities and the susceptibility for fragility fractures later in life.

This is a retrospective, multi-national, non-interventional chart review of patients (pts) with childhood HPP (symptom onset ≥6 months [mo] to <18 years [y]). Data were collected from 5 to 15 years of age or until Tanner stage >2, whichever occurred first. Study inclusion required HPP-related skeletal abnormalities, ≥1 set of paired radiographs 6 mo–5 y apart, and 2 height measurements ≥3 y apart. Children who previously received experimental or other treatments impacting bone or growth were excluded. Co-primary outcome measures were change in bone health (evaluated by the 7-point Radiographic Global Impression of Change (RGI-C) scale (-3 = severe worsening; +3 = complete healing) and change in height Z-score (Centers for Disease Control and Prevention [CDC] growth charts). Data are reported as median (min, max).

32 pts (69% boys, 97% white, 78% North American) were enrolled at 9 clinical sites, including 22 children from a large natural history database maintained at one site (2). Age at HPP symptom onset was 1.3 y (0.6, 3.4); age at diagnosis was 3.3 y (1.0, 13.1). Common HPP-related disease characteristics in this cohort included gait disturbance (59%), arthralgia (53%), bone pain (50%), muscle weakness (47%), muscle pain (38%), and fracture (34%). 28% of pts reported HPP-related hospitalizations, primarily for surgical correction of HPP-related deformity. 94% required non-pharmacological interventions such as physiotherapy (34%), orthotics (31%), and mobility aids (13%). 63% received medications for HPP-related complaints, most frequently for relief of pain and discomfort. No significant change between first and last assessment (LA) (time elapsed: 4.25 y [0.66, 7.95]) in radiographic assessment of bone health was observed (RGI-C was +0.33 [-2.33, +2.33; p=0.08]). Height and weight z-scores at first assessment varied considerably within the cohort (-0.86 [‑4.9, +2.6]; -0.86 [-5.0, +2.1], respectively) and all subsequent assessments, with no significant change to LA (p>0.05); at LA, height was -0.92 (-4.9, +1.8) and weight -0.98 (-5.7, +2.1).

As demonstrated by this retrospective chart review study, these children with childhood HPP had morbidity and no significant change in rickets or height z-score during childhood and early adolescence.

Objective/Methods: Stature reflects skeletal size, which is achieved by bone mineral accretion during childhood growth. Thus, we investigated the effects of genetic variants known to associate with adult height on pediatric bone mineral content and density. We leveraged a prospective observational study of 691 participants of European ancestry enrolled in the Bone Mineral Density in Childhood Study (52% female), then sought further support from an additional cohort of 472 Caucasian subjects (51% female). Bone mineral content (BMC) and areal bone mineral density (aBMD) of the radius, hip, spine and total body (to estimate head and whole body BMC/aBMD) were assessed by dual energy X-ray absorptiometry (DXA) and expressed as age and sex-specific Z-scores. We further tested bone Z-scores adjusted for height-for-age Z-score to account for known effects of size on DXA outcomes. DNA was extracted from blood/saliva and genotyped using high-throughput technology. Genotyping of subjects was performed at the Children’s Hospital of Philadelphia using the Illumina Infinium™ II OMNI Express plus Exome BeadChip technology.

Results: Three of the loci previously linked to adult height yielded Bonferroni-corrected significance for association with pediatric bone accretion at specific skeletal sites. These loci were rs3750972 at TPCN2 for head aBMD in males (P = 5.48x10^-5; ß = 0.241), rs6952113 at C7orf58 (also known as CPED1) for both BMC and aBMD at the distal radius in females (P = 1.63x10^-5; ß = -0.250 and P = 6.30x10^-8; ß = -0.317, respectively), and rs2781373 at MAX with aBMD at the distal radius in females (P = 3.22x10^-5; ß = 0.243). These loci did not show any degree of significant association with height Z-score, nor did height adjustment of BMC/aBMD outcomes dramatically alter the significance of association of these loci to their respective skeletal phenotypes. Additionally, 19 other adult height loci demonstrated at least a nominally significant, directionally consistent association in both the discovery and replication cohorts for a variety of other skeletal phenotypes.

Conclusions: These results indicate that at least some of the genetic variants associated with adult height may be exerting their influence via alterations in pediatric bone accretion. Additionally, our data have implicated TPCN2 and MAX as novel pediatric bone density loci.

Hypothesis
This work focuses on strategies to increase the resistance of β-cells against auto-immune destruction. We consider the possibility that activation of nicotinic acetylcholine (nACh) receptors protects β-cells against auto-immunity. NACh receptors have been previously implicated in the control of cell death, by the activation of their α7 subunit (1) and are expressed on β-cells.

Methods
Islets isolated from wild type (WT) mice, from mice in which either the α7 or β2 subunit of nACh receptors had been disrupted, as well as Human islets were cultured in presence or absence of nicotine or choline. After 24h, a cocktail of IL-1β+TNFα+IFNg was added. Cell death was quantified by TUNEL analysis. The expression of genes implicated in the regulation of mitochondrial permeability transition was quantified by qPCR.

Results
The exposure of WT mouse islets to the above-mentioned cytokines increased β-cell death, but the pre-culture with nicotine significantly decreased the effect of cytokines (median: 0.7 vs. 1.0 arbitrary units (a.u.); p < 0.01). The experiment was repeated with islets form mice in which either the α7 or the β2 subunit of nACh receptors had been disrupted. We found that nicotine significantly decreased cell death also in the absence of the β2 subunit (median: 0.67 vs. 1.0 a.u.; p < 0.01), but not in the absence of the α7 subunit, indicating that the effect was dependent on this latter subunit. We then repeated the experiment on Human and WT murine islets, with a pre-culture with choline, a specific agonist of the α7 subunit. We found that choline also attenuated (median: 0.78 vs. 1.0 a.u.; p < 0.05) the effect of the cytokines, confirming the importance of the α7 subunit for the protective effect. We then quantified the expression of genes implicated in the regulation of mitochondrial permeability transition by qPCR and found that the cytokines induced the expression of CHOP, a marker of endoplasmic reticulum (ER) stress (2) as well as of PUMA, a protein of the Bcl-2 family (2). For both genes, the effect of the cytokines on their expression was significantly attenuated (4.6 ± 0.3 vs. 11.3 ± 1.8 a.u.; p < 0.01 for CHOP and 0.7 ± 0.07 vs. 1.5 ± 0.2 a.u.; p < 0.05 for PUMA) by pre-incubation with choline.

Conclusion
Our results show that the activation of nACh-receptors via their α7 subunit significantly reduces cytokine-induced β-cell death in mouse and Human islets. This effect was linked to attenuation of ER-stress and modulation of PUMA a pro-apoptotic protein implicated in the regulation of mitochondrial permeability transition. We believe that these results open the exciting perspective of a pharmacological modulation of beta-cell resistance against auto-immunity.

Hypothesis: We   hypothesized   that hyperglycemia   induces abnormal   patterns of   cerebral blood flow including diminished cerebral tissue perfusion as reflected in increased TTP in patients investigated for but not found to have ischemic stroke.

Methods: We  studied  the perfusion images of 75 patients who were not found  to have stroke and correlated with their blood glucose level at admission (BGA). 25 patients with BGA <100mg/dl served as the control group whereas 25 with BGA 100-140mg/dl constituted Group A and 25 patients with BGA >140 formed Group B.  Each group was then studied in detail for the cortical and hypothalamic blood flow parameters (CBV, CBF, TTP) using the Vitrea software.

Results: We found that the cortical TTP increased by 17% in both groups A (p=0.019) and B (p=0.033) when compared with the control and  there was a statistically significant rise in TTP  in each sector of the cortex in both hemispheres. Hypothalamic TTP also increased by 12% in group A (p=0.031) and by 1.8% in group B (p=0.386), when compared with  the control group (BGA <100).  There was no significant change in cortical or hypothalamic CBF or CBV.

Conclusion: We  conclude that  in patients without stroke, a blood glucose >100mg/dl, is associated with significant increases in TTP in the cortex and the hypothalamus. Since TTP  is  inversely related  to cellular and  tissue perfusion, our study shows for the first time a reduction in cerebral tissue perfusion at glucose concentrations >100mg/dl. These observations  have  implications  for the pathogenesis of  adverse  outcomes related to hyperglycemia in patients with ischemic stroke and, therefore, similar studies need to be carried out in patients with stroke.

Aim:To study a subset of proangiogenic monocytes/macrophages expressing TIE2 receptor (TEMs) and its natural ligand, Angiopoietin-1 (ANG1), before and after chronic PDE5i by sildenafil (SILD) in patients with T2DM and mouse models of type1- and -2 diabetes mellitus (STZ and db/db).

Results: We found specific changes in TEMs recruitment in both human and mouse models of diabetes. In this context PDE5i: 1) normalized ANG-1 levels (2.1±0.6 ng/dl; after SILD 6.8±2.8 P<0.01) and circulating TEMs in men with T2DM (TEM frequency 46.1±18.9; after SILD, 76.0±21.5, P <0.01), and restored the angiogenic function of their serum; 2) lowered circulating pro-inflammatory monocytes in patients (CD14⁺CD16^- cells: 29.0±7.3 T2DM; after SILD 12.4±6.4, P<0.01) and in mice (CD11b⁺Gr-1⁺cells in STZ: 53.7±7.9 vs. STZ+SILD: 30.4±8.3, P<0.01; db/db 46.1±10.0 vs. db/db+SILD 26.5±7.5, P<0.01); 3) reversed renal and heart organ damage, restoring pericytes regular coverage of endothelial cells, normalizing vascular architecture and increasing proangiogenic TEMs (TEM frequency,  in STZ kidney 6.9±2.7 vs. 30.9±3.6 in STZ+SILD, P<0.01; in STZ heart 5.8± 0.9 vs. 25.1±14.0 in STZ+SILD, P<0.01; in db/db heart: 16.5±2.1 vs. 53.0±16.9 in db/db+SILD, P<0.05; in db/db isoproterenol treated heart 14.0±2.8 vs. 52.2±17.9 in isoproterenol+SILD, P<0.01) 4) antagonized isoproterenol-induced cardiac hypertrophy (p<0.05); 4) inhibited vascular inflammation modulating ANG1/TIE2 pathway.

Conclusion: In summary, we demonstrate that circulating, renal and cardiac TIE2+ proangiogenic myeloid cells are defective in diabetes, especially in injured tissues, and that sildenafil normalizes their levels, by promoting the shift from classic (M1-like) to alternative (M2-like)/TIE2+ macrophage polarization via ANG1. Restoration of TEMs via PDE5i stimulation of angiopoietin-1 improves microcirculation and could help prevent diabetic complications associated with defective tissue repair.

In the present study, we have studied whether an intact action of TLRs in the adrenocortical cells or in the immune system within adrenal microenvironment is crucial for activation of adrenal glucocorticoid production, inflammation, immune cell infiltration, and adrenal cell death during endotoxemia-provoked SIRS and polymicrobial sepsis.

In particular, we engaged mice with inactivation of a key adapter molecule involved in TLR signaling (Myeloid differentiation primary response gene 88, MyD88) in adrenocortical cells (Akr1b7-Cre-MyD88 fl/fl) and in the hematopoietic cells only (Vav-Cre-MyD88 fl/fl). By subjecting these mice to LPS, we demonstrated that an intact TLR-signaling in immune but not adrenocortical cells is the major regulator of adrenal gland inflammation, including enhanced expression of pro-inflammatory mediators and immune cell infiltration. In addition, we identified that an intact TLR signaling in immune cells was necessary for a proper activation of the HPA axis.

Our data suggest that an intact immune rather than adrenocortical TLR signaling is critically involved in the regulation of the immune-adrenal crosstalk regulating the adrenal glucocorticoid production and inflammation.

Li-juan Yin, Fan Fan, Yan Wang, Xinlei Sun , and Jian Lu*

Department of Pathophysiology, the Second Military Medical University, 800 Xiangyin Road, Shanghai 200443, People’s Republic of China.

Abstract

Glucocorticoid (GC) can affect tumor biology not only for its immunosuppression and antiinflammatory effects, but also play a direct role in regulating proliferation, differentiation, adhesion, invasion and apoptosis of tumor cells. Our previous works demonstrated that dexamethasone (Dex), a synthetic GC significantly increased cell adhesion to extracellular matrix (ECM) by increasing levels of integrins b1, a4 and  a5, thereby enhancing cell resistance to chemotherapeutics in human ovarian cancer cells. However it is unclear whether Dex also affect the expression of components of ECM as ligands of integrin b1, and whether other membrane molecules besides integrin are involved in pro-adhesion effect of Dex in ovarian cancer cells. In order to further explore the mechanism of pro-adhesion and anti-apoptotic effects of Dex, in the present study we investigated the effect of Dex on the expression of components of ECM, cell adhesion glycoprotein CD44 and mucin antigen 1(MUC1), a large transmembrane epithelial mucin glycoprotein by QRT-PCR， Western blot and Elisa /Radioimmunoassay（RIA）. The results demonstrated that 100 nM Dex treatment significantly up-regulated the expression of fibronectin and MUC1 in ovarian cancer HO-8910 and SKOV3 cells, but did not change the expression of collagen I, III and IV，and laminin, as well as CD44 and its principal ligand hyaluronan(HA). Since in addition to binding to integrin a5b1, fibronectin also binds to CD44. While we demonstrated that treatment of ovarian cancer cells with CD44 blocking antibody significantly decreased the pro-adhesion effect of Dex, suggesting that up-regulation of fibronectin may be also involved in the pro-adhesion effect of Dex by fibronectin-CD44 interaction. Moreover Dex could activate PI-3K –AKT pathway probably through enhanceing cell adhesion, which contributed to enhancing cell resistance to chemotherapy. Finally we found that  inhibiting the expression of  fibronectin and MUC1 with specific siRNAs significantly attenuated the pro-adhesion and activation of AKT induced by Dex. In conclusion, these results indicated that  up-regulation of fibronectin and MUC1 and activation of PI-3K-AKT pathway  by Dex are involved in pro-adhesion and anti-apoptotic effects of Dex in human ovarian cancer cells.  

1. Yu-Xia Chen,et al. Endocrine-Related Cancer. 2010, 17 (1): 39 -50; 2. Herr I, et al. Cancer Research. 2003, 63: 3112–3120. 3. Sui M, et al. International Journal of Cancer 2006, 119: 712–717.

Source of Research support: the National Natural Science Foundation of China (91029722 and 81472690)).

Methods In vitro transactivation of the hGR was studied in COS-7 cells co-transfected with the hGR and the luciferase reporter vectors MMTV and pRL-TK. Cells were treated with either cortisol or one of the test compounds in increasing concentrations. Transactivation of the hGR was measured using a dual luciferase assay. Dose-response curves were calculated and the half maximal effective concentration (EC₅₀) was determined for each steroid. Maximal transactivation by the steroids relative to the maximal transactivation by cortisol was calculated. In the second part of our study, nuclear translocation of the hGR was studied by transfection of COS-7 cells with a GFP-tagged hGR and fluorescence microscopy after treatment of the transfected cells with the steroids.

Results The EC₅₀ of cortisol was 1.7 x 10^-8 M. 17OHP, P and 21DF transactivated the hGR with EC₅₀s of 2.2 x 10^-6 M,  3.0 x 10^-6 M and 1.0 x 10^-7 M, respectively. For 17OHP and 21DF maximal transactivation was not significantly different from the maximal transactivation by cortisol (respectively 86%, p=0.06 and 97%, p=0.8), but for P maximal transactivation was significantly lower (73%, p=0.004). Δ4 did not transactivate the hGR. Treatment of the cells transfected with the GFP-tagged hGR with 21DF led to complete nuclear translocation of the hGR, whereas treatment with 17OHP or P resulted in partial nuclear translocation of the hGR.

Conclusions Our data suggest that 17OHP, P and 21DF are able to transactivate the hGR and thus may have clinically relevant glucocorticoid activity. For 17OHP and P, high concentrations are needed to achieve transactivation of the hGR. For 21DF however, the concentration needed to reach the EC₅₀ is only approximately 6-fold the concentration of cortisol. Serum concentrations of 21DF reached in untreated CAH patients (up to approximately 4.5 x 10^-7 M), might therefore have a clinically relevant agonistic effect on the hGR and could partially compensate the cortisol deficiency in these patients.

CBX inhibited 11β-HSD1 activity (pmol active corticosterone from inactive 11-dehydrocorticosterone/h) by 66-89% in unwounded skin and during WH (p<0.001). 11β-HSD1 activity was 50% greater in aged mice 2 days post-wounding (5.4 vs. 3.6pmol/h, p<0.01). Aged mice displayed impairments in epidermal barrier function i.e. increased baseline transepidermal water loss (TEWL, g water/h/m²) 7.3 vs. 4.5 (p<0.001) and integrity i.e. increased TEWL per tape strip 9.9 vs. 5.4 (p<0.001). CBX further impaired integrity in aged mice (12.8, p<0.05) with a similar trend for baseline TEWL (9.4, p=0.09). Wounds of aged vs. young mice were 40% smaller at day 2 (6.5 vs. 10.7mm², p<0.001) but comparable at days 4 and 8. CBX-treated wounds in aged mice were 30% larger at day 2 (p<0.05) with trends indicating altered mRNA expression of pro-inflammatory cytokines (IL1β, 3.9-fold, p=0.12, TNFα, 5.3-fold, p=0.1), extracellular matrix remodelling (COL1, 0.15-fold, p=0.2, MMP9, 5-fold, p=0.17, TIMP1, 0.29-fold, p=0.18) and mesenchymal-epidermal signalling (FGF7, 0.26-fold, p=0.13, IGF1, 0.3-fold, p=0.09). CBX had no effect on any measured outcomes in young mice.

These findings suggest increased local GC activation modestly improve barrier function and early WH in healthy aged mice partly in response to/by suppressing increased inflammation. However, this could predispose aged individuals to the adverse effects of systemic stress e.g. delayed WH. Associations between 11β-HSD1, stress and ageing merit further exploration.

Methods: The surgical trauma model was induced by partial hepatectomy. Ninety-six male rats were randomly divided into 4 groups: the intact group (INT; n=24); the model group, which received partial hepatectomies (M, n=24); the sham group, which included model animals that received acupuncture without an electric circuit (Sham, n=24); and the EA group, which comprised model animals that received EA (EA, n=24). EA treatment was given twice: 24 h before the surgery and immediately after the partial hepatectomy was completed. The expression of hypothalamic CRF and CRFR, the glucocorticoid receptor (GR), the GABA receptor, plasma adrenocorticotropic hormone (ACTH) and plasma corticosterone (Cort) were observed at 2 h, 4 h, 8 h and 24 h after surgery.

Results: Strikingly, there were higher levels of plasma ACTH in M at 4 h and 24 h after surgery, while the plasma Cort expression was higher than INTs at 2 h, 4 h, 8 h and 24 h after surgery. And the ACTH and Cort expressions in EA presented lower than those of Ms. The hypothalamic CRF and GR increased in M at 2 h and 4 h after surgery, while those in EA decreased to normal levels. The expression of the hypothalamic GABAA α2 subunit and the GABAB receptor were enhanced in M compared with INTs, while were normalized with EA treatment compared with M. 

Conclusion: Our data suggest that EA attenuated the hyperactivity of the HPA axis by the regulation of hypothalamic GABAA and GABAB receptors on hypothalamic CRF. The hypothalamic GABAA α2 subunit may play an important role in inhibitory regulation of  hypothalamic CRF expression.

Keywords: Electroacupuncture; Surgical Trauma; CRF; GABAA Receptor; GABAB Receptor

Body condition score (BCS, obesity) was recorded in female or castrated male healthy horses (n=7), EMS (n=5) and PPID cases (n=6) destined for euthanasia. Plasma ACTH, serum cortisol and insulin were measured by immunoassay; plasma testosterone by LC-MS/MS. Glucocorticoid and androgen metabolites in post-mortem urine samples were quantified by GC-MS/MS and corrected for creatinine. mRNA transcript levels of 11β-HSD1, 5α-reductase (type 1) and 5β-reductase in adipose (neck crest, linea alba, peri-renal) and liver were quantified by qPCR.

20β-Dihydrocortisol, a negligible metabolite in humans, was the most abundant urinary cortisol metabolite (60% of total metabolite excretion) in horses; testosterone was the major urinary androgen. Compared with healthy horses, EMS cases had higher BCS (P<0.001), hyperinsulinaemia (P=0.002) and increased total urinary androgens (1.6 ± 1.5 v 11.4 ± 7.5µg/mmol, P=0.02) and cortisol metabolites (41±3.4 v 132.4 ± 21.0µg/mmol, P=0.002), largely due to increased 20b-dihydrocortisol. Plasma ACTH, serum cortisol and androgens were normal. 11β-HSD1 transcript levels were higher in all adipose depots (P=0.006) but not in liver. Both 5α and 5β reductase were increased in liver (P=0.004). PPID cases were older (P=0.01) than healthy horses with elevated plasma ACTH (257.8 ± 217.1 v 39.6 ± 19.7pg/ml, P<0.001) but were not obese and had normal plasma cortisol (98±50 v 109±20nmol/L) and androgens; urinary cortisol and androgen metabolites were elevated, with increased testosterone (P=0.01), 20b-dihydrocortisol (P=0.02) and, disproportionately, 5b-reduced cortisol metabolites (P=0.03). Transcripts of 11β-HSD1 were increased in peri-renal adipose only (P=0.001).

In conclusion, EMS and PPID are both characterised by enhanced clearance of cortisol and adrenal androgens. This increased clearance may cause activation of the HPA axis contributing to elevated ACTH in PPID and adrenal stimulation in EMS. Given the normal plasma cortisol and androgen concentrations, the equine Cushing’s phenotype may result from altered local steroid metabolism, including by an unidentified 20β-oxoreductase. Glucocorticoid clearance may be a therapeutic target in these horses.

Design: Serum remaining from routine analysis was aliquoted and distributed to four different centres for cortisol analysis by their respective immunoassay. In addition an aliquot was analysed by our routine LC-MS/MS assay and candidate LC-MS/MS reference method to provide a traceable result for comparison of assay bias. Cohort groups included: normal subjects, patients taking the oral contraceptive pill (OCP), pregnant patients, patients taking prednisolone and patients taking the the 11β-hydroxylase inhibitor metyrapone. Cortisol binding globulin (CBG) was measured in the normal, OCP and pregnant cohorts.

Results: Considerable bias was observed in the normal cohort between the immunoassays when compared to the LC-MS/MS candidate reference method whereas excellent agreement was observed between the routine LC-MS/MS assay and LC-MS/MS candidate reference method. Over recovery was greatest in patients taking prednisolone with the Roche platform particularly affected. Analysis of CBG demonstrated that elevated concentrations are observed during pregnancy and in patients taking the OCP when compared to the normal cohort. Elevated concentrations of CBG were associated with under-recovery in the Abbott Architect immunoassay. Of the patients taking metyrapone positive bias was observed across all immunoassay platforms when compared to the LC-MS/MS reference method.

Conclusions: The accurate quantification of cortisol by current immunoassays is compromised by both the non-specificity of the antibody for cortisol and matrix effects including elevated concentrations of CBG. Users should be aware of the limitations of their current assay and consider these when interpreting results, this is especially true of patients taking metyrapone where the dosage is titrated against cortisol concentration.

We tested the hypothesis that women who engaged in higher levels of physical activity will have lower cortisol, adrenaline (Adr), noradrenaline (NA) and dopamine (DA) responses to a TSST compared with their relatively less active counterparts.

High and low fit women (n=22 per group; in the follicular phase of the menstrual cycle) were subjected to a TSST (Kirschbaum, Pirke et al. 1993) at 1500h. Concentrations of cortisol, Adr, NA and DA were measured in samples of blood collected every 7-15min from 1400h-1700h.  Cortisol, Adr, NA and DA were compared within and between groups using repeated measures ANOVA.

Physical activity levels (2.7±0.5 vs 7.1±1.3 hours per week; p=0.004) and VO_{2 max} (27.4±1.0 vs 41.9±1.6 ml/kg*min; p<0.001) were significantly higher in high fit women compared with low fit women Both groups responded to the TSST with a substantial elevation of cortisol (107%; p<0.001), Adr (146%; p<0.002), NA (92%; p<0.001) and DA (44%; p<0.001) but this response did not differ significantly between high and low fit women (time * treatment for cortisol, Adr, NA and DA; p=0.987, p=0.118, p=0.169, p=0.392, respectively). Furthermore, there were no significant differences between high and low fit women in pre-treatment values, peak height, reactivity or area under the curve for cortisol, Adr and NA (p>0.05 for all).  For DA, reactivity was higher in the low fit women (p=0.009) compared with the high fit women.  DA pre-treatment values, peak height, reactivity or area under the curve were similar between the groups.

While both groups had substantial responses to psychological stress, high fit women did not have an attenuated HPA axis and SAM system responses to psychological stress compared to low fit women. These findings suggest that, for low fit women who are aged between 30-50 years, the response of plasma cortisol, Adr, NA and DA to a potent acute psychological stressor is not compromised compared to that in high fit women.  Nevertheless, it is possible that differences between the groups may have been seen with a less potent stressor.  Further research is needed to clarify the role of physical activity in stress responsiveness.

The GST is used to evaluate GH and HPA axes in adults with pituitary disorders. Two prospective studies have reported that a GH cut-off level of 3 ng/mL differentiates those with GHD from healthy adults. The Endocrine Society Guidelines recommend a GH cut-off value of 2.5-3 ng/mL for the diagnosis of adult GHD. Recent studies suggest a lower GH cut-off especially in obese patients. Weight-based GST has been used in children, but data are limited in adults.

Objective:

To define GH cut-off values to diagnose adult GHD by GST, and to compare fixed dose (FD, 1 mg, 1.5 mg in patients >90 kg) with weight based (WB, 0.03 mg/kg, maximum 3 mg) GST.

Methods:

28 patients with adult-onset hypothalamic-pituitary disease and 1-2 (G1, n=14) or ≥3 (G2, n=14) pituitary hormone deficiencies were randomized to ITT, FD- and WB-GST (4 hrs) 5-28 days apart at 4 centers. A 3^rd group of 14 control subjects (G3) was matched for age (±10 yr), sex, estrogen status and BMI (±5 kg/m²).  A GH response <3 ng/mL to ITT was used to classify patients as GH deficient.  Three subjects aged >65 years classified as GHD based on ≥3 pituitary deficiencies and low IGF-1 did not undergo the ITT.

Results:

Age and sex ratio were comparable between the 3 groups. Median (range) BMI was similar among the groups: G1 28.2 (18.6-36.3), G2 30.2 (19.8-46.2), and G3 27.3 (23.0-46.6). Mean (± SD) standardized IGF-1 levels were higher in controls compared with G1 and G2 (-0.5 ± 1.3 vs. -1.6 ± 1.1 and -1.9 ± 0.7, respectively). Glucagon dose used during the FD- and WB-GST was 1.2 ± 0.2 and 2.4 ± 0.5 mg, respectively.

The best GH cut-point for GHD diagnosis was 1.0 (92% sensitivity, 100% specificity) and 2.0 ng/mL (96% sensitivity and 100% specificity) for FD- and WB-GST, respectively. No significant change in these cut-off values were found if a GH <5 ng/mL was used to define GHD during ITT. Peak GH and BMI negatively correlated during FD- and WB-GST (r= -0.15 to -0.20, p= 0.21 to 0.33), but did not reach statistical significance. Age negatively correlated with the peak GH during FD-GST (r= -0.32, p= 0.04), but not WB-GST (r= -0.21, p= 0.21). Late peak GH (after 3 hours) was seen in 4.8% and 9.5% of the subjects during FD- and WB-GST, respectively.

During FD- and WB-GSTs, 7.1-21.4% of patients developed hypoglycemia (glucose <50 mg/dL) vs. 0% in controls. Nausea was the most common side effect (FD-GST 38% and WB-GST 50% of patients). One patient had a grand mal seizure during FD-GST without hypoglycemia. The FD-GST was preferred by patients over the other two tests, while no significant difference was seen between ITT and WB-GST.

Conclusion:

Our data do not support the use of GH cut-point of 3 ng/mL during FD- or WB-GST. Such a cut-off value may lead to misclassification of some adults as GH deficient. It is unclear whether a lower cut-point is required specifically for patients with higher BMIs. FD-GST was not inferior to WB-GST for GHD diagnosis and was preferred by most patients over the WB-GST and ITT.

 Objective: IGF-1 was measured by both RIA and mass spectrometry (LC-MS/MS ) in serum samples from patients with pituitary disorders .

 Methods: Serum samples  prospectively obtained from 101 patients with both naïve and treated secretory and non-secretory pituitary tumors, cysts, hypophysitis,and craniopharyngioma, were evaluated by IGF-1 mass spectrometry (MS) and by Siemens Immulite 2000 IGF-1 assay (reagent lot #512; solid phase, enzyme-labeled chemiluminscent immunometric assay).  After sample accrual, samples were submitted for each assay as a single batch.  

Results: Although results of the two assays were highly correlated (R²=0.97), a significant positive bias was observed in the RIA  compared to the MS assay, reflecting a systematic proportional difference observed between  Siemens and LCMS assays, with the Siemens typically reporting higher results than the LCMS. This is reflected in the slope of the relationship observed in Deming regression y=1.57x – 54.0 and linear regression analyses y=1.55x – 48.3, . where y is the  Siemens assay  value . For classification into normal or abnormal values from each assay, results  were interpreted according to their respective reference intervals. IGF-1 MS assay results were interpreted using published age-adjusted ranges (1) and for the Siemens assay, according to age-adjusted ranges provided in the directional insert. Twenty six of 99 (27.2%) samples for which reference ranges were available for both assays, were classified differently (in range, low, or elevated) by the Siemens and the IGF-1 LCMS assay.  All 26 disagreements occurred with LCMS in the reference range: 14 were with elevated RIA  and 12 with low RIA.  LCMS was in the reference range significantly more frequently than RIA, 72.7% versus 46.5% of the cases, McNemar P < 0.0001.

 Conclusion: While results of  IGF-1 testing with the RIA  and LC-MS/MS assays  were highly correlated, a strong positive bias with higher results was reported using RIA compared to LC-MS/MS.  Twenty seven percent of IGF-1 samples measured by the two assays  were differently classified indicating a large degree of inter-assay variability. Inter-assay variability for IGF-1 results is well established and caution should be used when interpreting results of differing methodologies.The  accuracy of the IGF-1 LCMS methodology, large reference ranges, and concordance of  published LCMS reference ranges with a large published reference population (2 ) reinforces the clinical utility  of the mass spectrometry based IGF-1 assay

Aims: We assessed the impact of a single bolus dose of PegV on the GH/IGF axis in adults suspected of GH deficiency with low IGF-I levels.

Study Design: In this proof-of-concept pilot study, 10 adults suspected of adult GH deficiency received a single bolus dose of SC PegV (1 mg/kg). Blood GH, GH binding protein (GHBP), total IGF-I, IGF-I bioactivity, IGFBP-2, and IGFBP-3 levels were measured at baseline and 72 hrs after SC PegV administration.

Methods: GH was measured using an automated assay that excludes PegV interference, where a monoclonal antibody that does not cross-react with PegV was combined with a monoclonal antibody specific for 22-kD GH; IGF-I was measured by commercial immunoassays using the automated iSYS platform; GHBP was measured by a modification of the ligand immunofunctional assay with an in-house monoclonal anti-GHBP antibody; in vitro IGF-I bioactivity was measured by an in-house IGF-I receptor kinase receptor activation assay, where the assay detects the ability of serum to phosphorylate the IGF-I receptor in vitro; PegV was measured by a two-site competitive immunofluorometric assay, where serum samples were diluted 100-fold to minimize potential GH interference.

Results: A total of 10 patients [5M/5F; age (mean ± SE) 40.8 ± 2.5 yrs; BMI 29.6 ± 2.5 kg/m²] with hypothalamic-pituitary disease, 1-3 pituitary hormone deficiencies and low IGF-I (IGF-I SDS -2.0 ± 0.3) were recruited. Administration of PegV increased GH (prePegV 0.13 ± 0.04 vs postPegV 0.41 ± 0.15 ng/mL; P < 0.01) and GHBP (626 ± 114 vs 1073 ± 174 pmol/L; P < 0.001), decreased total IGF-I (85.1 ± 8.3 vs 64.8 ± 10.2 ng/mL; P < 0.05) and IGF-I bioactivity (1.09 ± 0.08 vs 0.93 ± 0.08 µg/L; P < 0.05), but did not alter IGFBP-2 and IGFBP-3 levels. Serum PegV levels positively correlated with GH (r = 0.83; P < 0.01), ΔGH (r = 0.85; P < 0.01), ΔGHBP (r = 0.85; P < 0.01), and negatively correlated with IGF-I bioactivity (r = -0.61; P< 0.05). No subject reported any adverse reactions to the PegV injections.

Conclusion: A single bolus high dose PegV not only exerts acute GH receptor blockade and lowers total IGF-I levels but also decreases IGF-I bioactivity acutely, independent of altering IGFBP-2 and IGFBP-3 levels even in states of low IGF-I levels. Further studies are needed to verify if the reduction in IGF-I bioactivity with a single bolus high dose PegV is sustainable over time when high PegV doses are administered daily, as this is clinically relevant especially when treating patients with acromegaly.

Methods:Sixty women with subfertility at high risk of OHSS, as identified by high serum anti-mullërian hormone >40 pmol/l and antral follicle count >23 on ultrasound, were randomized to receive a single subcutaneous dose of kisspeptin-54 to trigger oocyte maturation following a standard recombinant FSH / GnRH antagonist protocol. An adaptive dose allocation protocol was utilized, randomizing the first 15 participants to 3.2, 6.4 or 12.8 nmol/kg kisspeptin-54 (n=5 per group). Following interim analysis, remaining participants were randomized to receive either 6.4, 9.6 or 12.8 nmol/kg of kisspeptin-54 (n=15 per group). Oocytes were retrieved 36h after kisspeptin-54 administration, assessed for maturation (primary outcome), and fertilized by intracytoplasmic sperm injection with subsequent transfer of 1-2 embryos. All women were screened for the development of both early and late OHSS by assessment with symptomatology, pelvic ultrasound and blood analysis.

Results:Oocyte maturation was observed in 95% (57/60) of women following kisspeptin-54 administration. Embryo formation did not occur in 3 women, and a clinical decision was made to electively freeze embryos in a further 3 women; thus 51 of 60 women had fresh embryo transfer. Biochemical and clinical pregnancy rates per transfer at all doses of kisspeptin-54 tested were 63% (32/51) and 53% (27/51), respectively. Highest pregnancy rates were seen following 9.6 nmol/kg of kisspeptin-54, which resulted in a 77% (10/13) clinical pregnancy rate per transfer. Eight from 60 women had mild to moderate OHSS, but no woman had severe or life-threatening OHSS requiring medical admission or intervention.

Conclusion: Use of kisspeptin-54 to trigger oocyte maturation with subsequent fresh embryo transfer resulted in high clinical pregnancy rates and low rates of OHSS. Thus kisspeptin-54 shows great potential for future clinical use to safely and effectively trigger oocyte maturation in IVF therapy, even in women at high risk of OHSS.

Methods: Male Lewis rats (n=6/group) were injected with either vehicle (controls) or PAS-LAR (0.1, 0.5, 1, 4, 8, 80mg/kg). Blood samples were collected 24h (all doses) and 14 days (only 4, 8 and 80mg/kg) after a single injection of different doses of PAS-LAR. Serum IGF-I and GH were measured by immunoassay. GH concentrations were determined from serial blood samplings (10 samples during 5h) and analyzed by rank-plots. Genes of interest were quantified in liver tissue by real-time PCR (4, 8 and 80mg/kg groups).

Results: Starting with a dose of 0.5mg/kg, either dose of PAS-LAR strongly suppressed GH secretion after 24h and lowered IGF-I by about 20% (0.5mg/kg), 40% (1mg/kg) or 65% (4, 8 and 80mg/kg) vs. controls (p<0.001). Injection of 0.1mg/kg did not show an effect on GH and IGF-I secretion. 14 days after injection, GH was still suppressed in rats treated with any dose (albeit to a smaller degree compared to GH-suppression after 24h). 80mg/kg was most effective, while 4mg/kg and 8mg/kg did not differ significantly. In contrast, IGF-I was suppressed in a dose-dependent manner 14days after treatment. As expected, hepatic IGF-1 expression was significantly lower after 24h and 14days in all PAS-groups. Interestingly, after 14days, each PAS-LAR dose lowered (approx. 50%) expression of the hepatic GH-receptors (p<0.01).

Conclusion: Suppression of GH and IGF-I was significantly higher 24h after the injection of PAS-LAR compared to 14days after injection pointing towards a tachyphylaxis effect. As expected, PAS-LAR dose-dependently suppressed serum IGF-I after 24h and 14days. In contrast, suppression of GH did not show a dose-dependency. Therefore we may suggest direct effects of PAS-LAR on suppression of serum IGF-I which are independent from pituitary GH inhibition. Furthermore, the observation of significantly lower hepatic GH-receptor expression with PAS-LAR fuels the speculation that PAS may also inhibit IGF-I secretion through extra-pituitary mechanisms.

AIM: To evaluate the efficacy of metformin in newly-diagnosed acromegaly patients during treatment with SSA.

Material and methods: 19 newly-diagnosed acromegaly patients (4 men, 15 women; median  age 55 [IQR 50 -62] years) without known DM underwent an oral glucose tolerance test (OGTT) with glucose and insulin levels assessment every 30 minutes for 2 hours. OGTT performed at baseline and after 6 months of SSA therapy. Early carbohydrate metabolism disturbance  and DM  were diagnosed according to WHO recommendations. From the fasting plasma glucose (FPG) and  insulin (FPI), HbA1c,  index of insulin resistance (НОМА-R), index of insulin sensitivity (MATSUDA-index), area under insulin curves (AUCins) were calculated. Examined patients were randomized into 2 groups: without metformin treatment (group 1), n=13, and with metformin treatment (group 2), n=6.

Results: With SSA treatment, we observed a significant reduction in growth hormone (from 32.4 to 8.4 ng / ml, p <0.01) and the percentage of IGF-1 upper normal limit (from 171 to 26.9 %, p <0.01). In group 1 we observed a tendency of HOMA-R reduction from 2.4 to 2.2 (p=0.08) and increase in the level of Matsuda index from 2.7 to 4.5 (NS). FPI fell from 71 pmol / l to 57.2 pmol / l (p <0.05) and the AUCins ( in 1.3 times), especially its first phase secretion (in 3.7 times) (p <0.05). HbA1c levels and FPG increased from 5.8% to 6.0% (p <0.05), and from 5.3 mmol / l to 6.1 mmol / l (p <0.05) respectively. In group 2 (metformin group) we observed a tendency of a decrease of  HOMA-R from 7.8 to 1.5 (NS ) and the increase of  the Matsuda index from 1.7 to 8.3 (NS), reduction of FPI from 166.5 pmol / l to 38.0 pmol / l (p <0.05), AUCins ( in 2.5 times) (p <0.05), especially its first phase (in 4 times) (p <0.05). HbA1c levels and FPG decreased from 6.5% to 6.1% and  from 8.0 mmol / l to 7.0 mmol / l respectively, (NS).

Conclusions: SSA therapy reduced insulin resistance on one hand, but also reduced the first phase of insulin secretion. Metformin treatment  reduced FPG and HbA1c, but had not effect on the first phase insulin secretion.

It is recognised that women are less sensitive to exogenous GH than men, and therefore need higher GH doses than men to achieve the same levels of insulin-like growth factor-I (IGF-I). However, it is not clear whether this knowledge is applied in the clinical practice of GH replacement for patients with GHD.

Objective

To evaluate the changes in IGF-I, serum lipids, waist circumference, fasting blood glucose (FBG) and metabolic status relative to gender and GH dose, during 4-years of GH therapy in adults with GHD. 

Methods

Patients with adult-onset GHD receiving GH therapy (Norditropin^®, somatropin, Novo Nordisk A/S) enrolled in NordiNet^® IOS with 4 years of follow-up data were evaluated. Descriptive statistics were applied. A t-test was used to analyse change from baseline in GH dose, IGF-I standard deviation score (SDS), BMI, waist circumference, lipids and FBG. Stratification by baseline FBG enabled analysis of conversion of metabolic status (normal: 3.9–5.5 [70–100]; prediabetes/impaired glucose tolerance: 5.6–7.0 [101–126]; diabetes: ≥7.0 [126] mmol/L [mg/dL]) during GH therapy.

Results

Data were analyzed for 822 adult patients (44.9% female). Mean (SD) GH dose (females 0.31 [0.23]; males, 0.28 [0.22] mg) increased significantly from baseline to 4 years, but to a greater extent in females (mean difference [95% CI]: 0.07 [0.03; 0.10] mg/day; p<0.001). A significant increase (and to similar levels) in mean (SD) IGF-I SDS from baseline values (females, –0.88 [1.32]; males, –0.53 [1.38]) was observed at 4 years (females, 1.51 [1.28; 1.75]; males, 1.48 [1.21; 1.75]; p<0.001 vs. baseline for both) in both genders. During 4 years of follow-up, a significant reduction in LDL-cholesterol from baseline was observed in males (p<0.0316) but not in females (females, –0.07 [–0.32; 0.17]; males, –0.24 [–0.46; –0.02] mmol/L) and FBG significantly increased in females but not in males (females, 0.44 [0.15; 0.73]; p=0.0033; males, 0.13 [–0.16; 0.41] mmol/L; ns). Most (84.1%) patients had normal metabolic status at baseline. The proportion of patients with prediabetes at baseline who had normal metabolic status at 4 years was higher in males than in females (females 55% vs. 25%).  

Conclusions

Despite a higher baseline GH dose and dose increase in female than in male patients, 4-year GH treatment outcomes were generally better in males than in females. Although there seems to be clinical awareness of women needing higher GH doses than men, GH doses used may still be insufficient to overcome gender-related GH-resistance.

Objective.  To test the hypothesis that age, sex steroids, insulin, body composition and physical power determine dynamic GH responses, viz., GH autofeedback and feedforward.

Design. Prospectively randomized glucose-blinded design.

Setting.  National Center for Advancing Translational Sciences.

Participants.  Healthy men ages 19-77 yr (N = 23).

Interventions.  Fasting/rest/saline, fasting/exercise/saline and fasting/rest/iv glucose infusions were used to drive GH dynamics during 10-min blood sampling for chemiluminescence GH assay.

Outcomes.  Stepwise correlation analysis to relate peak/nadir GH dynamics to age, sex steroids, insulin, CT-estimated abdominal fat and physical power (work per unit time).

Results.  Compared with the fasting/rest/saline (control) day, fasting/exercise/saline infusion evoked peak GH within 1 h, followed by negative feedback 3-5 h later.  The dynamic GH excursion was strongly (coefficient of determination, R² = 0.634) influenced by (i) insulin negatively (P = 0.011), (ii) power positively (P = 0.0008), and (iii) E₂ positively (P = 0.001).  The dynamic range of glucose-modulated GH release was determined by insulin negatively (P = 0.0039) and power positively (P = 0.0034) [overall R² = 0.454].  Under control conditions, power (P = 0.031) and total abdominal fat (P = 0.012) [R² = 0.267] were the dominant correlates of GH excursions. 

Conclusion.  In healthy men, dynamic GH perturbations induced by exercise and glucose are strongly related to physical power, insulin, estradiol, and body composition, thus forging a network of regulatory pathways.

Objective:To report the clinical, genetic, and molecular features of a familial presentation of the TUBB3 E410K syndrome 

Methods: Case report of a mother and three affected children with clinical features of the TUBB3 E410K syndrome. Genetic analysis of the TUBB3 gene was done by Sanger sequencing. Endocrine and non-endocrine phenotypes of the proband and family members were ascertained by clinical history and physical examination.

Results:  A de novo TUBB3 c.1228G>A mutation arose in a female proband who displayed CFEOM, facial weakness, intellectual and social disabilities, and anosmia. However, she underwent normal sexual development at puberty and had three spontaneous pregnancies with subsequent autosomal dominant inheritance of the mutation by her three boys, thus suggesting incomplete penetrance of hypogonadotropic hypogonadism. All sons displayed non-endocrine features of the TUBB3 E410K syndrome similar to their mother, but in contrast to their mother,  had variable features suggestive of additional neuroendocrine abnormalities including hypogonadotropic hypogonadism, hypoadrenalism, growth hormone deficiency and central hypothyroidism.

Conclusions:  This first report of a familial autosomal dominant inheritance of the TUBB3 c.1228G>A mutation  provides new insights into the spectrum of endocrine phenotypes associated with the TUBB3 E410K syndrome. The presence of anosmia without hypogonadotropic hypogonadism in the proband also demonstrates that TUBB3 mutations may have dissociated effects on the ontogeny of olfactory axons and GnRH neurons. These observations emphasize the need for appropriate clinical evaluation and complicate genetic counseling of patients and families with this syndrome.

Methods:  Patients who had been operated between 2000 and 2012 in a large tertiary neurosurgical referral center and had completed the survey on the diagnostic process also filled in self-rating questionnaires on depression (Beck Depression Inventory II; BDI-II), QoL (Short Form 36; SF-36) and embitterment (Bern Embitterment Inventory; BEI). The data of 165 valid answer sets were analyzed using SPSS.

Results: Patients in the study did not suffer, on average, from increased embitterment or an overall reduced QoL. Male patients had significantly higher performance related embitterment scores than women, who in turn, had a significantly worse psychological Qol than men and were more depressed. Number of doctors consulted in the diagnostic process was significantly associated with emotional embitterment, pessimism and hopelessness, (BEI), physical and mental quality of life (SF-36) and depression (BDI-II). Consistently, time delay from first seeking medical advice to diagnosis was also significantly related to the same parameters of the BEI, SF-36 and BDI-II (p ≤ 0.05 – 0.001).

Conclusion: Delayed diagnosis of acromegaly has severe consequences in terms of psychosocial impairment and is associated with higher scores on many subscales of the embitterment questionnaire in patients with acromegaly. The results underscore the need to maximize efforts to establish better diagnostic algorithms for speedier diagnosis. Furthermore, the results should be taken into account for developing psychological supportive treatments for the affected patients.

Transgenic medaka embryos were treated with 1µM of RFRP-3 from day 0 until hatch. GnRH3-GFP intensity in the TN and trigeminal (TG) areas were recorded using an epifluorescent microscope on 2-4 days post fertilization. Social behavior of larvae was tested at 3 weeks post hatch in a 10cm x 8cm enclosure with 2cm of normal fish water. A fish larva was placed in the chamber under the following conditions with a/an – i) opaque wall; ii) mirror; iii) mirror on one side and a live fish separated by a clear barrier on the other; iv) opaque wall on one side and a live fish separated by a clear barrier on the other. Both RFRP-3 exposed and vehicle treated control fish were exposed to each condition. For tracking, the tank was divided into three equal segments, the mirror/wall region, center region, and a non-mirror/live-fish region. Fish behavior was recorded for 3 minutes after starting the trial and analyzed using the Noldus EthoVision software.

RFRP-3 treated fish showed no significant difference in GnRH3-GFP fluorescence intensity at 3dpf but showed 56% increased intensity at 4dpf (n=12, p<0.01) in the TN and 36% increase the TG (n=12, p<0.05). While there was no overall difference between motion between control and RFRP-3 treated medaka, treated fish were found to spend 70% more time near the mirror under condition (ii) as compared to control fish (p<0.05). We suggest that RFRP-3 exposure may be affecting the GnRH3 neuron development, which could then lead to altered social behavior.

This is a retrospective study of pediatric patients who received GnRHa therapy for 12 months. Age, gender, diagnosis and anthropometric data, including BMI standard deviation score (SDS) were obtained at baseline and at three month intervals.

29 patients (23 females, 6 males; age at start of therapy 10.89 years + 2.3, BMI SDS 0.61 + 0.87 kg/m2) received leuprolide acetate monthly (leuprolide group). 9 patients (31%) had CPP, 9 (31%) had early puberty (puberty between the ages of 8-9 for females and 9-10 for males) and 11 (38%) had short stature treated with leuprolide and growth hormone (GH) (one patient had CPP and GHD). 9 subjects were treated with histrelin (7 females, 2 males; age at start of therapy 11.8 years + 2.3, BMI 0.7 + 0.9 SDS kg/m2, all with the diagnosis of CPP) (histrelin group).

No significant change in BMI SDS was detected in the children with CPP treated with either leuprolide or histrelin. Mean BMI SDS increased significantly from baseline after 12 months of leuprolide therapy in subjects without CPP by 0.165 + 0.073 (p=0.035). When stratified for gender, males had a mean BMI SDS increase of 0.22 + 0.099 (p=0.018). A transient increase in BMI SDS was observed at 6 months only in females treated with both leuprolide and growth hormone (BMI SDS increase of 0.191 + 0.692, p=0.022), whereas no change in BMI SDS was noted after 12 months of therapy.

Our data support that GnRHa therapy does not adversely affect BMI in children with CPP. An increase in BMI SDS, which involved primarily males, was detected in subjects without a diagnosis of CPP treated with leuprolide acetate. These findings need to be confirmed with larger studies and can have significant clinical implications for children who receive such therapy.

Materials and Methods: We examined the clinical and genetic features of 13 IHH patients: 3 cases with anosmia (Kallmann syndrome, KS) and 10 cases normosmic IHH (nIHH). Additional clinical parameters were recorded: testicular volume, cryptorchidism, cleft lip and/or palate, neurological, dental, renal and craniofacial anomalies. All patients were screened for mutations by using direct sequencing of the entire coding region of the KAL1, FGFR1, FGF8, PROK2, PROKR2, NELF, GnRH1, GnRHR, TAC3, TACR3, KISS1, KISS1R, and CHD7 genes.

Results: Of all 13 patients, 11 were sporadic cases and 2 were from one consanguineous family. All patients, aged 20-45 year, were men and were found to have micropenis and delayed puberty. Five patients had cryptorchidism. Among patients with KS, 2 had renal agenesis and 1 had septo-optic dysplasia (SOD) feature. Mutations were identified in all KS patients and the one family of nIHH. The KS group harbored mutations in KAL1 (c.653_654delTG; p.Val218fsX11) and FGFR1 (c.303C>G; p.Cys101Trp). Digenic mutations, KAL1 (c.1540G>A; p.Glu514Lys) and FGFR1 (c.203G>A; p.Arg68Gln), were identified in the patient with SOD feature. One of the nIHH patients was found to carry a novel homozygous mutation in GnRHR (c.721_742+1delGTCCTTCATCAGGACCCCCCACG).

Conclusions: Our study demonstrated the clinical and genetic features of the Thai patients with IHH. Furthermore, we reiterated the expanding phenotypic spectrum of IHH, in particular its impact on the development of the anterior midline forebrain

Methods/Cohort We screened 63 HH/KS (M:F 50:13) patients in our cohort, 41 with isolated HH and 22 KS, with 40% of the total having associated abnormalities, for variants in the five most commonly mutated genes, KAL1, PROKR2, FGFR1, FGF8 and GnRHR, using PCR and direct sequencing analysis.

Results We identified 4 variants, two of which were novel. A novel hemizygous missense substitution, KAL1 c.257G>A, p.C86Y, was identified in a male KS patient. A novel FGFR1 heterozygous deletion (c.915delG, p.[Leu305LeufsX6]), causing a frameshift, was identified in two siblings who presented with anosmia: a male with cleft lip/palate and short stature, and a female with a microform cleft lip. The mutation was inherited from the unaffected father. Two previously described variants, that have not been functionally characterized, were also identified in our cohort: a hemizygous early stop codon, KAL1 c.1267C>T, pR423X, in a KS patient and a heterozygous missense substitution, FGFR1 c.2059 G>A, p.G687R, in a male patient with isolated HH who is currently showing signs of reversal after stopping treatment. His mother had primary amenorrhoea and also carries the variant, his father was unaffected and his DNA was unavailable. All four variants are located at highly conserved residues across multiple species and were not present on any control databases.

Conclusion We report two novel and two previously described variants in two different candidate genes in four unrelated HH/KS patients. The potential genetic cause remains unknown in 94% of our HH cohort, signifying the need for further investigation into genes involved in GnRH neuronal migration and secretion, which might be potentially responsible for the pathogenicity.

Objective: To investigate potential pathogenic variants in the promoter region of MKRN3 in patients with GnRH-dependent pubertal disorders. Variants in the MKRN3 promoter region could result in changes in gene expression and lead to CPP or constitutional delay of growth and puberty (CDGP)

Methods: We studied fifty patients with idiopathic CPP and 25 patients with CDGP. A family history of precocious or delayed sexual development was present in 28% and 32% patients, respectively. Inactivating mutations in the coding region of MKRN3 were excluded in all patients with CPP. Genomic DNA was extracted from peripheral blood leucocytes and a 1000 bp region (-750 to +350 relative to the transcriptional site) of the MKRN3 gene, including potential transcription factor recognition site motifs (PEA3, SRE, SRF, C/EBP, AP2, testis-R), was amplified and automatically sequenced.

Results: We identified a variant, g.23565509T>A (rs182933790), in the promoter region of MKRN3 in a female patient with CPP, who had the onset of pubertal development at age 6.6 years. This variant was also identified in one male patient with CDGP and in one out of 20 control individual suggesting a lack of genotype-phenotype correlation. Furthermore the variant was identified in 1% of the African population from phase 1 of the 1000 Genome Project and the minor allele frequency of this variant was < 0.01, indicating that it is a rare nucleotide change.

Conclusion: No pathogenic variants were detected in the MKRN3 promoter region of patients with idiopathic GnRH-dependent pubertal disorders.

In addition, TransCon hGH was shown in two Phase 1 studies in Healthy Volunteers and a Phase 2 study in adults with hGH Deficiency (AGHD) to: 1) be safe and well tolerated, 2) possess dose dependent, predictable levels of growth hormone, 3) be suitable for a once-weekly dosing regimen, 4) induce an IGF-I pharmacodynamic (PD) response within the normal range throughout the dosing period.

Objectives: The objective of this study is to investigate 1) safety and tolerability, 2) pharmacokinetics (PK) and pharmacodynamics, and 3) efficacy of TransCon hGH in children with Growth Hormone Deficiency.

Design and methods: Pre-pubertal, treatment naïve GHD children received s.c. injections of one of three once-weekly TransCon hGH doses (0.14, 0.21 and 0.30 mg hGH/kg/week) or daily hGH (Genotropin®; 0.03 mg hGH/kg/day = 0.21 mg/kg/week) over a six-month treatment period, in a  randomized, comparator-controlled dose response Phase 2 study. The patients’ GHD diagnosis were established in accordance with international consensus guidelines, based on auxology (height & height velocity), GH stimulation tests & IGF-I. Children Small for Gestational Age (SGA) were excluded.

Results: Safety and efficacy (annualized height velocity), as well as PK and PD data, of up to 25 patients treated over a six-month period with TransCon hGH or daily hGH will be presented. In an interim analysis conducted following three months of treatment all TransCon hGH doses demonstrated an excellent safety / local tolerability profile and an excellent growth within expected ranges (above 10 cm annualized HV) that was comparable to daily hGH.

Conclusions: To date, TransCon hGH has demonstrated efficacy and safety comparable to that observed with daily hGH. Injection site reactions have generally been mild and similar to what is expected with daily hGH injections, with no nodule formation or lipoatrophy noted. This TransCon hGH Phase 2 study conducted in a pediatric population confirms the excellent safety and efficacy profile observed in previous clinical trials.

Design and methods: A randomized, controlled Phase 2 study was conducted in up to 56 pre-pubertal, naïve GHD children receiving subcutaneous injections of one of MOD-4023 doses as a once-weekly regimen (range: 0.25 - 0.66 mg/Kg per week) or daily hGH (34 µg/Kg/day) as a control arm. MOD-4023 and IGF-1 levels were monitored throughout the study. Annual Height Velocity (HV) assessment was evaluated at 12 months.

Results: The baseline characteristics were comparable between all groups. PK/PD profile following administration of MOD-4023 demonstrated a significantly extended half-life as with a dose dependent PK/PD (IGF-1) response was observed between MOD-4023 dose cohorts, reaching steady state with no accumulation or excessive levels by 12 months.  All cohorts demonstrated expected “catch-up” growth, in line with reported age- and GHD severity-matched data. All cohorts demonstrated 12m annual HV above 11 cm/year, correlated with the PK/PD profile in those patients.  Sub analysis of HV response which was based on baseline characteristics confirmed an excellent response is all sub populations.  The 12 months safety analysis suggests a clean and promising profile with no unexpected adverse events.

Conclusions: This is the first report describing PK, PD, efficacy and safety results of extended, 12 months, treatment period with MOD-4023 in pediatric patients with GHD. MOD-4023 administration to GHD children further confirmed its long acting properties. This study further affirmed that a single weekly injection of MOD-4023 has the potential to replace seven consecutive daily injections of currently marketed hGH in pediatric GHD patients and provided data for dose selection for the company’s upcoming Phase 3 trial.

Design and methods: A randomized, comparator-controlled Phase 2 study was conducted in up to 56 pre-pubertal, naïve GHD children receiving one of three MOD-4023 doses as once-weekly regimen (0.25, 0.48, 0.66mg/Kg per week) or daily hGH (34µg/Kg/day) as comparator arm in subcutaneous injections. In order to introduce naïve patients to the allocated MOD-4023 dose in a gradual manner, a stepwise dose increase approach was implemented. All patients randomized to receive one of the three MOD-4023 doses started treatment for 2 weeks with the low MOD-4023 dose and based on the patient's dose allocation, followed by a dose increase to the next dose level every two weeks until the final allocated dose was reached. Subsequently to the second dose administration of the targeted dose MOD-4023, GH, IGF-1 and IGF-BP3 concentrations were measured on monthly basis and PK-PD analysis was conducted utilizing a population based approach up to 12 months of treatment.

Results: MOD-4023 administration confirmed its long acting properties and superior properties compared to daily hGH. The weekly profile suggests extended half-life, increased exposure and reduced clearance for all patients. Pre-dose and trough levels indicated no accumulation of circulating MOD-4023. IGF-1 and IGF-1 SDS following MOD-4023 administration also increased at a dose proportional manner.

The MOD-4023 profile of throughout the 12 months study reached steady state during the first few weeks of treatment with no indication for excessive levels or accumulation as monitored at 6 month by evaluating trough levels. IGF-1 seem to be normalized and stabilized within the normal range during study and prior to completion the 52 weeks of treatment reaching an optimal value of 0 SDS for the two higher MOD-4023 cohorts which was comparable to the daily hGH arm. As anticipated, IGF-BP3 levels increased following MOD-4023 administration reaching steady state levels by week 15 post study initation.

Conclusions: MOD-4023 once-weekly treatment at three different doses for 52 weeks demonstrated an excellent PK and PD profile supporting once weekly injection in pediatric GHD population and therefore can potentially promote proper growth. In addition, the changes observed in IGF-1 and IGF-BP3 demonstrate adequate stimulation of the GH-IGF-1 axes which were shown to be comparable to that observed with daily hGH treatment

TransCon hGH is a once-weekly prodrug of recombinant human growth hormone (hGH) intended to improve compliance and treatment outcome of patients requiring growth hormone therapy. TransCon hGH is designed to maintain the same mode of action and distribution within the body as daily administered hGH. TransCon hGH liberates unmodified hGH into the bloodstream via a non-enzymatic self-cleaving process relying only on physiological pH and temperature conditions, which ensures predictable release of unmodified hGH. The hGH released from TransCon hGH has been demonstrated to be identical to hGH for daily administration, for which safety and efficacy has been established through decades of therapy. In clinical studies, TransCon hGH has demonstrated an efficacy, safety, tolerability and immunogenic profile that is comparable to that of daily hGH.

Objectives

To compare the structure and in vitrobiopotency of growth hormone released from TransCon hGH with hGH for daily administration, and compare the exposure of hGH released from TransCon hGH with daily administered hGH, together with the resulting IGF-I levels in GHD adults.

Design and methods

hGH released from TransCon hGH was characterized by high resolution mass spectrometry, circular dichroism, N-terminal amino acid sequencing, peptide mapping and cell based biopotency assays. Pharmacokinetic and pharmacodynamic data of TransCon hGH and daily hGH was obtained in a Phase 2 study in GHD adults.

Results

Characterization of hGH released from TransCon hGH confirmed that it is unmodified and structurally identical to hGH for daily administration.  Cell based biopotency assays confirm that full activity of the growth hormone is restored when it is released from the prodrug. PK/PD data obtained from GHD adults show that maximum levels of both hGH and IGF-I are comparable between weekly administered TransCon hGH and daily administered hGH, with no supraphysiological exposure to either hGH or IGF-I.

Conclusion

Whether released from the pituitary gland or administered as daily injections, growth hormone distributes throughout the body to exert important effects in growth hormone responsive tissue, including bone, muscle, liver and fat tissue. These include anabolic and metabolic effects. Growth hormone released from TransCon hGH has been shown to be identical to hGH in daily administered products. Clinical studies in adults with GHD demonstrate that TransCon hGH has comparable efficacy to daily hGH when administered at the same cumulative weekly dose. Importantly, TransCon hGH does not cause supraphysiological exposure to hGH or IGF-I. 

Designed to maintain the same mode of action and distribution to growth hormone responsive tissues as daily hGH, TransCon hGH has the potential to offer patients requiring growth hormone therapy a long-acting alternative to daily injections

Youn Hee Jee, Kun Song Lee, Alan T. Remaley, Young Pyo Chang, Anton Wellstein, Jack A. Yanovski, Jeffrey Baron

Background: Midkine (MDK) and pleiotrophin (PTN) are two closely-related heparin-binding growth factors that in rodents are highly expressed in early life in multiple organs and decrease to undetectable levels by adulthood. The roles of MDK and PTN in human growth and development are unknown.

Objective: To examine associations of plasma MDK and urine PTN with age, sex, adiposity, and growth in children.

Methods: Plasma MDK was measured by ELISA in150 healthy children (mean age, 11.7 y; range 0 to 24 y; BMI SDS range, -2.3 to +3.2) and random urine PTN was measured by ELISA in 87 healthy children (mean age, 15.0 y; range 3 to 24.7 y; BMI SDS range, -2.3 to +2.7). Plasma MDK and urine PTN were also measured in 41 children referred for short stature (mean height SDS, -2.4), including idiopathic short stature (ISS, n=25), constitutional delay (n=12), growth hormone (GH) deficiency (n=1), and small for gestational age (n=3).

Results: In healthy children, plasma MDK concentrations declined with age (R²=0.41, p< 0.001) paralleling height velocity, with values highest in infants. Plasma MDK did not differ significantly between males and females and did not correlate with BMI SDS or percent total body fat. In most of the children with short stature, MDK concentrations did not differ significantly from normal subjects, regardless of diagnosis or GH treatment status, and did not correlate with height SDS or IGF-1 SDS. One 15-year old girl with ISS had 20 fold greater plasma MDK than the mean for age-matched controls (2.9 vs 0.14 ± 0.1 ng/mL, mean ± SD, n=29), and one newborn with intrauterine growth retardation had a low MDK concentrations compared to healthy newborns (0.17 vs 0.9 ± 0.5 ng/mL, mean ± SD, n=9). In healthy children, urine PTN normalized to creatinine (PTN/Cr) also declined with age (R²=0.3, p<0.001). Urine PTN did not differ significantly between males and females and did not correlate with BMI SDS or percent total body fat. However, 11 children with constitutional delay showed significantly higher PTN than age-matched controls or children with other causes of short stature (p<0.001).

Conclusions: In healthy children, plasma MDK concentrations and urine PTN/Cr ratio declined with age, paralleling the physiological decline in growth velocity and were not significantly associated with sex or adiposity. Plasma MDK concentration was markedly increased in one child with ISS and decreased in one SGA newborn. Urine PTN/Cr was elevated in constitutional delay. To establish whether MDK and PTN regulate human growth and whether abnormalities involving MDK or PTN could cause human growth disorders will require further investigation.